\
| Variant ID: vg1002838375 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 2838375 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 340. )
GTATAACATATTGATGAATGAGCTTTGCCGTGAGGGCAGGATGGTGGAGGCAAGGATGCTGTTTGATGAGATGTTGCAGGCTGGAGTTGAAGTGAATACA[A/G]
TCACGTTCAATGTTTTGATTGATGGTTATGCAAAGGCTGGACAGATGGAGAACGCTAACATGGCCTGCGCAGAGATGAAGGCCATGGGATTAATGCCTGA
TCAGGCATTAATCCCATGGCCTTCATCTCTGCGCAGGCCATGTTAGCGTTCTCCATCTGTCCAGCCTTTGCATAACCATCAATCAAAACATTGAACGTGA[T/C]
TGTATTCACTTCAACTCCAGCCTGCAACATCTCATCAAACAGCATCCTTGCCTCCACCATCCTGCCCTCACGGCAAAGCTCATTCATCAATATGTTATAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.20% | 6.70% | 3.09% | 0.00% | NA |
| All Indica | 2759 | 83.50% | 11.30% | 5.18% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 58.80% | 27.10% | 14.12% | 0.00% | NA |
| Indica II | 465 | 91.40% | 6.00% | 2.58% | 0.00% | NA |
| Indica III | 913 | 92.10% | 7.40% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 87.50% | 7.00% | 5.47% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 1.10% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1002838375 | A -> G | LOC_Os10g05680.1 | upstream_gene_variant ; 4919.0bp to feature; MODIFIER | silent_mutation | Average:77.915; most accessible tissue: Zhenshan97 young leaf, score: 90.175 | N | N | N | N |
| vg1002838375 | A -> G | LOC_Os10g05680.2 | upstream_gene_variant ; 4919.0bp to feature; MODIFIER | silent_mutation | Average:77.915; most accessible tissue: Zhenshan97 young leaf, score: 90.175 | N | N | N | N |
| vg1002838375 | A -> G | LOC_Os10g05660-LOC_Os10g05680 | intergenic_region ; MODIFIER | silent_mutation | Average:77.915; most accessible tissue: Zhenshan97 young leaf, score: 90.175 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1002838375 | 3.87E-06 | 1.99E-11 | mr1547 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002838375 | NA | 3.09E-09 | mr1547 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002838375 | 4.83E-07 | 4.95E-14 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002838375 | NA | 4.92E-13 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002838375 | NA | 1.77E-06 | mr1538_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002838375 | 2.41E-06 | 7.98E-13 | mr1547_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002838375 | 4.00E-06 | 2.10E-12 | mr1547_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002838375 | 3.51E-08 | 2.31E-27 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002838375 | NA | 1.40E-20 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |