\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002838375:

Variant ID: vg1002838375 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2838375
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 340. )

Flanking Sequence (100 bp) in Reference Genome:


GTATAACATATTGATGAATGAGCTTTGCCGTGAGGGCAGGATGGTGGAGGCAAGGATGCTGTTTGATGAGATGTTGCAGGCTGGAGTTGAAGTGAATACA[A/G]
TCACGTTCAATGTTTTGATTGATGGTTATGCAAAGGCTGGACAGATGGAGAACGCTAACATGGCCTGCGCAGAGATGAAGGCCATGGGATTAATGCCTGA

Reverse complement sequence

TCAGGCATTAATCCCATGGCCTTCATCTCTGCGCAGGCCATGTTAGCGTTCTCCATCTGTCCAGCCTTTGCATAACCATCAATCAAAACATTGAACGTGA[T/C]
TGTATTCACTTCAACTCCAGCCTGCAACATCTCATCAAACAGCATCCTTGCCTCCACCATCCTGCCCTCACGGCAAAGCTCATTCATCAATATGTTATAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.20% 6.70% 3.09% 0.00% NA
All Indica  2759 83.50% 11.30% 5.18% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 58.80% 27.10% 14.12% 0.00% NA
Indica II  465 91.40% 6.00% 2.58% 0.00% NA
Indica III  913 92.10% 7.40% 0.44% 0.00% NA
Indica Intermediate  786 87.50% 7.00% 5.47% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 1.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002838375 A -> G LOC_Os10g05680.1 upstream_gene_variant ; 4919.0bp to feature; MODIFIER silent_mutation Average:77.915; most accessible tissue: Zhenshan97 young leaf, score: 90.175 N N N N
vg1002838375 A -> G LOC_Os10g05680.2 upstream_gene_variant ; 4919.0bp to feature; MODIFIER silent_mutation Average:77.915; most accessible tissue: Zhenshan97 young leaf, score: 90.175 N N N N
vg1002838375 A -> G LOC_Os10g05660-LOC_Os10g05680 intergenic_region ; MODIFIER silent_mutation Average:77.915; most accessible tissue: Zhenshan97 young leaf, score: 90.175 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002838375 3.87E-06 1.99E-11 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002838375 NA 3.09E-09 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002838375 4.83E-07 4.95E-14 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002838375 NA 4.92E-13 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002838375 NA 1.77E-06 mr1538_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002838375 2.41E-06 7.98E-13 mr1547_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002838375 4.00E-06 2.10E-12 mr1547_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002838375 3.51E-08 2.31E-27 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002838375 NA 1.40E-20 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251