RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1002838375:

Variant ID: vg1002838375 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2838375
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 340. )

Flanking Sequence (100 bp) in Reference Genome:

GTATAACATATTGATGAATGAGCTTTGCCGTGAGGGCAGGATGGTGGAGGCAAGGATGCTGTTTGATGAGATGTTGCAGGCTGGAGTTGAAGTGAATACA[A/G]
TCACGTTCAATGTTTTGATTGATGGTTATGCAAAGGCTGGACAGATGGAGAACGCTAACATGGCCTGCGCAGAGATGAAGGCCATGGGATTAATGCCTGA

Reverse complement sequence

TCAGGCATTAATCCCATGGCCTTCATCTCTGCGCAGGCCATGTTAGCGTTCTCCATCTGTCCAGCCTTTGCATAACCATCAATCAAAACATTGAACGTGA[T/C]
TGTATTCACTTCAACTCCAGCCTGCAACATCTCATCAAACAGCATCCTTGCCTCCACCATCCTGCCCTCACGGCAAAGCTCATTCATCAATATGTTATAC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.20%	6.70%	3.09%	0.00%	NA
All Indica	2759	83.50%	11.30%	5.18%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	58.80%	27.10%	14.12%	0.00%	NA
Indica II	465	91.40%	6.00%	2.58%	0.00%	NA
Indica III	913	92.10%	7.40%	0.44%	0.00%	NA
Indica Intermediate	786	87.50%	7.00%	5.47%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	1.10%	3.33%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002838375	A -> G	LOC_Os10g05680.1	upstream_gene_variant ; 4919.0bp to feature; MODIFIER	silent_mutation	Average:77.915; most accessible tissue: Zhenshan97 young leaf, score: 90.175	N	N	N	N
vg1002838375	A -> G	LOC_Os10g05680.2	upstream_gene_variant ; 4919.0bp to feature; MODIFIER	silent_mutation	Average:77.915; most accessible tissue: Zhenshan97 young leaf, score: 90.175	N	N	N	N
vg1002838375	A -> G	LOC_Os10g05660-LOC_Os10g05680	intergenic_region ; MODIFIER	silent_mutation	Average:77.915; most accessible tissue: Zhenshan97 young leaf, score: 90.175	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002838375	3.87E-06	1.99E-11	mr1547	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002838375	NA	3.09E-09	mr1547	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002838375	4.83E-07	4.95E-14	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002838375	NA	4.92E-13	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002838375	NA	1.77E-06	mr1538_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002838375	2.41E-06	7.98E-13	mr1547_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002838375	4.00E-06	2.10E-12	mr1547_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002838375	3.51E-08	2.31E-27	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002838375	NA	1.40E-20	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 9 of 9 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg1002838375:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact