\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002827884:

Variant ID: vg1002827884 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2827884
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTAATAATAAAACAAGTCATAATAAAATGAATGATACTACATGATTTTTTTTAATGAGATGAATAGTTAGATGTGTTATTTTCAAAAGTCATATATTTA[G/A]
GAAATACAAGTTAGTAACATTCAACATTTTGATTAATTTGTGTTGCATAGAAAATCCACCCACCATTCTAGGACATTTAACTTTTCTATATCTGTGAAAA

Reverse complement sequence

TTTTCACAGATATAGAAAAGTTAAATGTCCTAGAATGGTGGGTGGATTTTCTATGCAACACAAATTAATCAAAATGTTGAATGTTACTAACTTGTATTTC[C/T]
TAAATATATGACTTTTGAAAATAACACATCTAACTATTCATCTCATTAAAAAAAATCATGTAGTATCATTCATTTTATTATGACTTGTTTTATTATTAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.10% 1.70% 0.17% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 94.20% 5.20% 0.53% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 90.50% 8.50% 1.04% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 96.30% 3.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002827884 G -> A LOC_Os10g05660.1 upstream_gene_variant ; 1267.0bp to feature; MODIFIER silent_mutation Average:55.01; most accessible tissue: Minghui63 root, score: 69.846 N N N N
vg1002827884 G -> A LOC_Os10g05650-LOC_Os10g05660 intergenic_region ; MODIFIER silent_mutation Average:55.01; most accessible tissue: Minghui63 root, score: 69.846 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002827884 NA 3.44E-06 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002827884 NA 1.82E-06 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002827884 NA 7.21E-07 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002827884 1.03E-06 1.03E-06 mr1430 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002827884 NA 3.46E-07 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002827884 NA 3.29E-06 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002827884 NA 6.33E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002827884 NA 3.54E-06 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251