Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002824453:

Variant ID: vg1002824453 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2824453
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.61, C: 0.40, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

AACTTTGTCACGTTTTACAATATATCATCGACTTTTGCTTAACTTCTACGATTTACCATCGCCGTCCAGTTAGCCTCCGTTAGCACTATACAATTTTGTC[T/C]
AAATGACCAAAATACCCCTAAGATAAAAACTTCTAAAATTTGGATAAAATTATCAAAATATCGTATTATGAACACAAGATTGTAAACATCCAAAATTTAG

Reverse complement sequence

CTAAATTTTGGATGTTTACAATCTTGTGTTCATAATACGATATTTTGATAATTTTATCCAAATTTTAGAAGTTTTTATCTTAGGGGTATTTTGGTCATTT[A/G]
GACAAAATTGTATAGTGCTAACGGAGGCTAACTGGACGGCGATGGTAAATCGTAGAAGTTAAGCAAAAGTCGATGATATATTGTAAAACGTGACAAAGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.40%	10.40%	0.25%	0.00%	NA
All Indica	2759	89.60%	10.10%	0.33%	0.00%	NA
All Japonica	1512	94.50%	5.50%	0.00%	0.00%	NA
Aus	269	59.90%	39.80%	0.37%	0.00%	NA
Indica I	595	97.80%	2.00%	0.17%	0.00%	NA
Indica II	465	69.50%	29.70%	0.86%	0.00%	NA
Indica III	913	93.60%	6.20%	0.11%	0.00%	NA
Indica Intermediate	786	90.60%	9.00%	0.38%	0.00%	NA
Temperate Japonica	767	91.70%	8.30%	0.00%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	95.40%	4.60%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	4.20%	1.04%	0.00%	NA
Intermediate	90	78.90%	20.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002824453	T -> C	LOC_Os10g05650.1	upstream_gene_variant ; 4830.0bp to feature; MODIFIER	silent_mutation	Average:61.357; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg1002824453	T -> C	LOC_Os10g05660.1	upstream_gene_variant ; 4698.0bp to feature; MODIFIER	silent_mutation	Average:61.357; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg1002824453	T -> C	LOC_Os10g05650-LOC_Os10g05660	intergenic_region ; MODIFIER	silent_mutation	Average:61.357; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002824453	NA	3.15E-06	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453	NA	5.00E-07	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453	4.56E-06	NA	mr1248	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453	NA	2.11E-07	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453	NA	2.02E-06	mr1358	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453	4.43E-06	4.43E-06	mr1430	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453	NA	2.28E-07	mr1515	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453	NA	7.45E-07	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453	NA	5.79E-07	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453	6.76E-06	6.76E-06	mr1649	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453	NA	2.15E-07	mr1877	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453	7.74E-06	7.74E-06	mr1992	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453	NA	7.44E-06	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453	NA	2.57E-07	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251