\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002824453:

Variant ID: vg1002824453 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2824453
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.61, C: 0.40, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


AACTTTGTCACGTTTTACAATATATCATCGACTTTTGCTTAACTTCTACGATTTACCATCGCCGTCCAGTTAGCCTCCGTTAGCACTATACAATTTTGTC[T/C]
AAATGACCAAAATACCCCTAAGATAAAAACTTCTAAAATTTGGATAAAATTATCAAAATATCGTATTATGAACACAAGATTGTAAACATCCAAAATTTAG

Reverse complement sequence

CTAAATTTTGGATGTTTACAATCTTGTGTTCATAATACGATATTTTGATAATTTTATCCAAATTTTAGAAGTTTTTATCTTAGGGGTATTTTGGTCATTT[A/G]
GACAAAATTGTATAGTGCTAACGGAGGCTAACTGGACGGCGATGGTAAATCGTAGAAGTTAAGCAAAAGTCGATGATATATTGTAAAACGTGACAAAGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.40% 10.40% 0.25% 0.00% NA
All Indica  2759 89.60% 10.10% 0.33% 0.00% NA
All Japonica  1512 94.50% 5.50% 0.00% 0.00% NA
Aus  269 59.90% 39.80% 0.37% 0.00% NA
Indica I  595 97.80% 2.00% 0.17% 0.00% NA
Indica II  465 69.50% 29.70% 0.86% 0.00% NA
Indica III  913 93.60% 6.20% 0.11% 0.00% NA
Indica Intermediate  786 90.60% 9.00% 0.38% 0.00% NA
Temperate Japonica  767 91.70% 8.30% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 95.40% 4.60% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 4.20% 1.04% 0.00% NA
Intermediate  90 78.90% 20.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002824453 T -> C LOC_Os10g05650.1 upstream_gene_variant ; 4830.0bp to feature; MODIFIER silent_mutation Average:61.357; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1002824453 T -> C LOC_Os10g05660.1 upstream_gene_variant ; 4698.0bp to feature; MODIFIER silent_mutation Average:61.357; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg1002824453 T -> C LOC_Os10g05650-LOC_Os10g05660 intergenic_region ; MODIFIER silent_mutation Average:61.357; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002824453 NA 3.15E-06 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453 NA 5.00E-07 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453 4.56E-06 NA mr1248 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453 NA 2.11E-07 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453 NA 2.02E-06 mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453 4.43E-06 4.43E-06 mr1430 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453 NA 2.28E-07 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453 NA 7.45E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453 NA 5.79E-07 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453 6.76E-06 6.76E-06 mr1649 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453 NA 2.15E-07 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453 7.74E-06 7.74E-06 mr1992 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453 NA 7.44E-06 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002824453 NA 2.57E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251