RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1002823994:

Variant ID: vg1002823994 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2823994
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCGTATTGTAATTAAATTTGTAATGTTTTCATGTAAGATTGATCAAGCTTAAAAAGTCTAATTCTTTTTTAAAAAAAATTAAAATGTCTTGTGAAACGG[A/C]
GGGGTACAATTTTTTAAGACAAATGATCAAATATATTTTTTAAGTATACTCCCTCCGTCTCAAGAAGAACGTATTTTAATTTTTTGTTTTTATGTCCAAC

Reverse complement sequence

GTTGGACATAAAAACAAAAAATTAAAATACGTTCTTCTTGAGACGGAGGGAGTATACTTAAAAAATATATTTGATCATTTGTCTTAAAAAATTGTACCCC[T/G]
CCGTTTCACAAGACATTTTAATTTTTTTTAAAAAAGAATTAGACTTTTTAAGCTTGATCAATCTTACATGAAAACATTACAAATTTAATTACAATACGAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.80%	2.10%	0.02%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	93.50%	6.50%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.40%	0.00%	0.00%	NA
Temperate Japonica	767	89.00%	10.80%	0.13%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	95.90%	4.10%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002823994	A -> C	LOC_Os10g05650.1	upstream_gene_variant ; 4371.0bp to feature; MODIFIER	silent_mutation	Average:36.765; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg1002823994	A -> C	LOC_Os10g05650-LOC_Os10g05660	intergenic_region ; MODIFIER	silent_mutation	Average:36.765; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002823994	NA	3.51E-08	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002823994	3.57E-07	3.57E-07	mr1166	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002823994	7.26E-06	2.39E-06	mr1171	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002823994	NA	2.80E-08	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002823994	7.91E-06	4.40E-09	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002823994	2.22E-06	3.56E-08	mr1358	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002823994	NA	1.06E-08	mr1515	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002823994	1.07E-06	1.07E-06	mr1547	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002823994	NA	8.93E-09	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002823994	NA	7.03E-08	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 13 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg1002823994:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact