\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002823994:

Variant ID: vg1002823994 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2823994
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCGTATTGTAATTAAATTTGTAATGTTTTCATGTAAGATTGATCAAGCTTAAAAAGTCTAATTCTTTTTTAAAAAAAATTAAAATGTCTTGTGAAACGG[A/C]
GGGGTACAATTTTTTAAGACAAATGATCAAATATATTTTTTAAGTATACTCCCTCCGTCTCAAGAAGAACGTATTTTAATTTTTTGTTTTTATGTCCAAC

Reverse complement sequence

GTTGGACATAAAAACAAAAAATTAAAATACGTTCTTCTTGAGACGGAGGGAGTATACTTAAAAAATATATTTGATCATTTGTCTTAAAAAATTGTACCCC[T/G]
CCGTTTCACAAGACATTTTAATTTTTTTTAAAAAAGAATTAGACTTTTTAAGCTTGATCAATCTTACATGAAAACATTACAAATTTAATTACAATACGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.80% 2.10% 0.02% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 93.50% 6.50% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.40% 0.00% 0.00% NA
Temperate Japonica  767 89.00% 10.80% 0.13% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 95.90% 4.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002823994 A -> C LOC_Os10g05650.1 upstream_gene_variant ; 4371.0bp to feature; MODIFIER silent_mutation Average:36.765; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg1002823994 A -> C LOC_Os10g05650-LOC_Os10g05660 intergenic_region ; MODIFIER silent_mutation Average:36.765; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002823994 NA 3.51E-08 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002823994 3.57E-07 3.57E-07 mr1166 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002823994 7.26E-06 2.39E-06 mr1171 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002823994 NA 2.80E-08 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002823994 7.91E-06 4.40E-09 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002823994 2.22E-06 3.56E-08 mr1358 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002823994 NA 1.06E-08 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002823994 1.07E-06 1.07E-06 mr1547 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002823994 NA 8.93E-09 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002823994 NA 7.03E-08 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002823994 1.43E-06 1.43E-06 mr1649 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002823994 1.56E-06 1.56E-06 mr1992 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002823994 NA 9.80E-07 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251