\
| Variant ID: vg1002771978 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 2771978 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 277. )
GCTTTATTTGGTCGCTACATAAAAATGGCCATTTTTCGGTCAAATCCATGTATAATGCGATCATCAATTCCAATGTAAGAATCCACAAGAGGATCTTATG[G/A]
GAGGTAAAGGTACCACTAAAAATCAAAGTATTTATGTGGTTTCTTCACAAAAAAAAGTAATCTTGACGAAAGATAATCTCATAAAGAGAAATTGAAGGGG
CCCCTTCAATTTCTCTTTATGAGATTATCTTTCGTCAAGATTACTTTTTTTTGTGAAGAAACCACATAAATACTTTGATTTTTAGTGGTACCTTTACCTC[C/T]
CATAAGATCCTCTTGTGGATTCTTACATTGGAATTGATGATCGCATTATACATGGATTTGACCGAAAAATGGCCATTTTTATGTAGCGACCAAATAAAGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.70% | 17.30% | 2.05% | 0.00% | NA |
| All Indica | 2759 | 94.80% | 2.40% | 2.86% | 0.00% | NA |
| All Japonica | 1512 | 59.90% | 39.80% | 0.26% | 0.00% | NA |
| Aus | 269 | 45.70% | 50.20% | 4.09% | 0.00% | NA |
| Indica I | 595 | 98.50% | 1.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 88.90% | 3.00% | 8.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.80% | 3.70% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 87.70% | 12.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 14.70% | 84.90% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 66.00% | 33.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 16.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1002771978 | G -> A | LOC_Os10g05580.1 | upstream_gene_variant ; 1057.0bp to feature; MODIFIER | silent_mutation | Average:12.295; most accessible tissue: Callus, score: 24.775 | N | N | N | N |
| vg1002771978 | G -> A | LOC_Os10g05570-LOC_Os10g05580 | intergenic_region ; MODIFIER | silent_mutation | Average:12.295; most accessible tissue: Callus, score: 24.775 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1002771978 | NA | 3.79E-06 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002771978 | NA | 5.79E-06 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002771978 | NA | 8.51E-06 | mr1220 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002771978 | 3.71E-07 | 1.89E-12 | mr1248 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002771978 | NA | 5.06E-09 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002771978 | NA | 9.46E-08 | mr1338 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002771978 | NA | 4.24E-06 | mr1425 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002771978 | NA | 1.54E-06 | mr1736 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002771978 | NA | 5.76E-07 | mr1742 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002771978 | 3.70E-06 | 8.20E-10 | mr1746 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002771978 | NA | 1.62E-08 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002771978 | NA | 7.30E-06 | mr1991 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |