\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002771247:

Variant ID: vg1002771247 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2771247
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.67, G: 0.33, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


AACTCGGTTCTTTCGAGTCTTCCCATGTTCATGTTATCCTTTTTTGAAATACCTCGAGGTGTACTTCAAAGATTGGATTACTACCGATCGAGCTTTTTCT[A/G]
GAGCAGTGATAGCTAGAAAAAGAAATATCGGTTAACAAAATAGGATTATATATGCCGGCCAAAAGATCAAGGTGGACTGGGTGTCCTAAATCTTGATATC

Reverse complement sequence

GATATCAAGATTTAGGACACCCAGTCCACCTTGATCTTTTGGCCGGCATATATAATCCTATTTTGTTAACCGATATTTCTTTTTCTAGCTATCACTGCTC[T/C]
AGAAAAAGCTCGATCGGTAGTAATCCAATCTTTGAAGTACACCTCGAGGTATTTCAAAAAAGGATAACATGAACATGGGAAGACTCGAAAGAACCGAGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.10% 20.70% 3.24% 0.00% NA
All Indica  2759 95.20% 3.30% 1.52% 0.00% NA
All Japonica  1512 43.30% 56.40% 0.26% 0.00% NA
Aus  269 84.40% 3.00% 12.64% 0.00% NA
Indica I  595 99.30% 0.30% 0.34% 0.00% NA
Indica II  465 97.00% 2.20% 0.86% 0.00% NA
Indica III  913 91.60% 6.00% 2.41% 0.00% NA
Indica Intermediate  786 95.30% 2.90% 1.78% 0.00% NA
Temperate Japonica  767 13.60% 86.40% 0.00% 0.00% NA
Tropical Japonica  504 90.10% 9.70% 0.20% 0.00% NA
Japonica Intermediate  241 40.20% 58.50% 1.24% 0.00% NA
VI/Aromatic  96 21.90% 9.40% 68.75% 0.00% NA
Intermediate  90 72.20% 20.00% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002771247 A -> G LOC_Os10g05580.1 upstream_gene_variant ; 1788.0bp to feature; MODIFIER silent_mutation Average:18.449; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg1002771247 A -> G LOC_Os10g05570-LOC_Os10g05580 intergenic_region ; MODIFIER silent_mutation Average:18.449; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002771247 NA 5.00E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002771247 NA 4.93E-07 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002771247 3.17E-06 3.17E-06 mr1146 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002771247 NA 3.74E-06 mr1220 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002771247 NA 2.09E-08 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002771247 NA 5.26E-06 mr1292 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002771247 NA 4.80E-06 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002771247 NA 2.83E-07 mr1415 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002771247 NA 2.13E-06 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002771247 NA 9.27E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002771247 NA 1.71E-08 mr1495 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002771247 NA 2.83E-07 mr1567 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002771247 NA 1.57E-07 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002771247 NA 4.50E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002771247 NA 5.13E-09 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002771247 NA 1.21E-06 mr1858 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002771247 NA 1.22E-06 mr1859 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002771247 NA 1.32E-06 mr1912 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002771247 NA 3.35E-07 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002771247 NA 2.22E-09 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002771247 NA 1.17E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002771247 NA 1.76E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002771247 NA 2.37E-08 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002771247 NA 1.45E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251