| Variant ID: vg1002771247 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 2771247 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.67, G: 0.33, others allele: 0.00, population size: 82. )
AACTCGGTTCTTTCGAGTCTTCCCATGTTCATGTTATCCTTTTTTGAAATACCTCGAGGTGTACTTCAAAGATTGGATTACTACCGATCGAGCTTTTTCT[A/G]
GAGCAGTGATAGCTAGAAAAAGAAATATCGGTTAACAAAATAGGATTATATATGCCGGCCAAAAGATCAAGGTGGACTGGGTGTCCTAAATCTTGATATC
GATATCAAGATTTAGGACACCCAGTCCACCTTGATCTTTTGGCCGGCATATATAATCCTATTTTGTTAACCGATATTTCTTTTTCTAGCTATCACTGCTC[T/C]
AGAAAAAGCTCGATCGGTAGTAATCCAATCTTTGAAGTACACCTCGAGGTATTTCAAAAAAGGATAACATGAACATGGGAAGACTCGAAAGAACCGAGTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.10% | 20.70% | 3.24% | 0.00% | NA |
| All Indica | 2759 | 95.20% | 3.30% | 1.52% | 0.00% | NA |
| All Japonica | 1512 | 43.30% | 56.40% | 0.26% | 0.00% | NA |
| Aus | 269 | 84.40% | 3.00% | 12.64% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.30% | 0.34% | 0.00% | NA |
| Indica II | 465 | 97.00% | 2.20% | 0.86% | 0.00% | NA |
| Indica III | 913 | 91.60% | 6.00% | 2.41% | 0.00% | NA |
| Indica Intermediate | 786 | 95.30% | 2.90% | 1.78% | 0.00% | NA |
| Temperate Japonica | 767 | 13.60% | 86.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 90.10% | 9.70% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 40.20% | 58.50% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 21.90% | 9.40% | 68.75% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 20.00% | 7.78% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1002771247 | A -> G | LOC_Os10g05580.1 | upstream_gene_variant ; 1788.0bp to feature; MODIFIER | silent_mutation | Average:18.449; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg1002771247 | A -> G | LOC_Os10g05570-LOC_Os10g05580 | intergenic_region ; MODIFIER | silent_mutation | Average:18.449; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1002771247 | NA | 5.00E-07 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002771247 | NA | 4.93E-07 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002771247 | 3.17E-06 | 3.17E-06 | mr1146 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002771247 | NA | 3.74E-06 | mr1220 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002771247 | NA | 2.09E-08 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002771247 | NA | 5.26E-06 | mr1292 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002771247 | NA | 4.80E-06 | mr1328 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002771247 | NA | 2.83E-07 | mr1415 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002771247 | NA | 2.13E-06 | mr1425 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002771247 | NA | 9.27E-06 | mr1446 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/