Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002768715:

Variant ID: vg1002768715 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2768715
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTACCCCTCCGTTTCACAATATAAATCGTTCTACCATTTTTCACATTCATATTAATGTTAATAAATCTATATAGATATATATGTCTAGATTCATTAACAT[C/A]
AATATAAATGTGGAAAATGTTAAAATGACTTACATCGTAAAACGGAGGAATTACTTGTTTTGCTTTTATTCTTTTGTGACTTTTTTAGTTTTTTTGTCGC

Reverse complement sequence

GCGACAAAAAAACTAAAAAAGTCACAAAAGAATAAAAGCAAAACAAGTAATTCCTCCGTTTTACGATGTAAGTCATTTTAACATTTTCCACATTTATATT[G/T]
ATGTTAATGAATCTAGACATATATATCTATATAGATTTATTAACATTAATATGAATGTGAAAAATGGTAGAACGATTTATATTGTGAAACGGAGGGGTAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.20%	19.50%	2.52%	3.79%	NA
All Indica	2759	91.50%	1.60%	4.28%	2.61%	NA
All Japonica	1512	43.70%	56.20%	0.00%	0.07%	NA
Aus	269	86.20%	1.10%	0.37%	12.27%	NA
Indica I	595	95.50%	0.30%	4.03%	0.17%	NA
Indica II	465	95.90%	1.50%	1.29%	1.29%	NA
Indica III	913	85.50%	2.40%	6.57%	5.48%	NA
Indica Intermediate	786	92.70%	1.80%	3.56%	1.91%	NA
Temperate Japonica	767	13.70%	86.30%	0.00%	0.00%	NA
Tropical Japonica	504	90.70%	9.30%	0.00%	0.00%	NA
Japonica Intermediate	241	41.10%	58.50%	0.00%	0.41%	NA
VI/Aromatic	96	21.90%	9.40%	0.00%	68.75%	NA
Intermediate	90	74.40%	17.80%	0.00%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002768715	C -> A	LOC_Os10g05570.1	upstream_gene_variant ; 4243.0bp to feature; MODIFIER	silent_mutation	Average:47.624; most accessible tissue: Callus, score: 85.489	N	N	N	N
vg1002768715	C -> A	LOC_Os10g05580.1	upstream_gene_variant ; 4320.0bp to feature; MODIFIER	silent_mutation	Average:47.624; most accessible tissue: Callus, score: 85.489	N	N	N	N
vg1002768715	C -> A	LOC_Os10g05570-LOC_Os10g05580	intergenic_region ; MODIFIER	silent_mutation	Average:47.624; most accessible tissue: Callus, score: 85.489	N	N	N	N
vg1002768715	C -> DEL	N	N	silent_mutation	Average:47.624; most accessible tissue: Callus, score: 85.489	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002768715	NA	1.37E-06	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	NA	4.03E-06	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	NA	1.40E-08	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	NA	1.83E-23	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	NA	5.88E-37	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	NA	5.86E-06	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	NA	5.89E-06	mr1446	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	NA	1.24E-07	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	NA	1.49E-09	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	NA	9.29E-07	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	NA	8.76E-08	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	4.61E-06	1.84E-20	mr1768	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	NA	9.04E-09	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	NA	6.12E-06	mr1912	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	NA	1.40E-41	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	NA	5.98E-06	mr1936	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	NA	5.12E-10	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	NA	5.65E-08	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	NA	1.27E-06	mr1123_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	NA	6.99E-06	mr1295_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	NA	3.50E-36	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	NA	1.18E-08	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	NA	1.05E-06	mr1679_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	NA	6.53E-07	mr1733_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	NA	1.23E-27	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	NA	8.55E-07	mr1936_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002768715	NA	5.22E-15	mr1959_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251