| Variant ID: vg1002758363 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 2758363 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 213. )
GCGGTAGACTGAACACCCACACAATCTCAATTTGACACAGCAACACTTTCCACCTCTCTTCCTTCCCTTGGATCAGATAGGAAATCCTCACTTTTCCAAG[A/G]
CAGAAGAGAAGCAAGCAACGGATTGAGCAACTAGCGTGAAAGAACAAGGGATGAGCGCTTTGTTGCTAAAGCGCATACGTTTTCTTGCTTGATTTTTATA
TATAAAAATCAAGCAAGAAAACGTATGCGCTTTAGCAACAAAGCGCTCATCCCTTGTTCTTTCACGCTAGTTGCTCAATCCGTTGCTTGCTTCTCTTCTG[T/C]
CTTGGAAAAGTGAGGATTTCCTATCTGATCCAAGGGAAGGAAGAGAGGTGGAAAGTGTTGCTGTGTCAAATTGAGATTGTGTGGGTGTTCAGTCTACCGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.40% | 20.80% | 0.36% | 3.41% | NA |
| All Indica | 2759 | 90.30% | 7.00% | 0.22% | 2.46% | NA |
| All Japonica | 1512 | 59.50% | 40.40% | 0.07% | 0.07% | NA |
| Aus | 269 | 29.00% | 58.70% | 1.12% | 11.15% | NA |
| Indica I | 595 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.80% | 1.30% | 0.00% | 0.86% | NA |
| Indica III | 913 | 80.50% | 13.40% | 0.11% | 6.02% | NA |
| Indica Intermediate | 786 | 91.00% | 7.30% | 0.64% | 1.15% | NA |
| Temperate Japonica | 767 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 13.90% | 85.90% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 65.60% | 34.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 34.40% | 0.00% | 6.25% | 59.38% | NA |
| Intermediate | 90 | 70.00% | 23.30% | 1.11% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1002758363 | A -> G | LOC_Os10g05560.1 | downstream_gene_variant ; 2250.0bp to feature; MODIFIER | silent_mutation | Average:28.939; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 | N | N | N | N |
| vg1002758363 | A -> G | LOC_Os10g05550-LOC_Os10g05560 | intergenic_region ; MODIFIER | silent_mutation | Average:28.939; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 | N | N | N | N |
| vg1002758363 | A -> DEL | N | N | silent_mutation | Average:28.939; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1002758363 | NA | 7.08E-06 | mr1063 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002758363 | NA | 7.47E-07 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002758363 | NA | 1.79E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002758363 | NA | 1.48E-07 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002758363 | NA | 6.53E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002758363 | NA | 9.30E-10 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002758363 | NA | 6.24E-06 | mr1292 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002758363 | NA | 2.68E-06 | mr1328 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002758363 | NA | 1.46E-06 | mr1425 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002758363 | NA | 2.09E-06 | mr1446 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/