\
| Variant ID: vg1002718424 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 2718424 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGGCGGCCACGCGGAACGGCCCGTCGGCGTCGGCGTCGTCGTCGTCGCAGATCAGCGTGGCGTTGCATCGGATGGAGTGATGGAGATGGAGTCGTTTATG[G/A]
GATGCCGCCTTGACGAGGCAGCGCTTGCCGGTGATGGGGTTGTAGACGAGGAAGTAGCAGGAGAATCTGCAGCAGCCGAGCAGGACGCGGCCGCCGCGGC
GCCGCGGCGGCCGCGTCCTGCTCGGCTGCTGCAGATTCTCCTGCTACTTCCTCGTCTACAACCCCATCACCGGCAAGCGCTGCCTCGTCAAGGCGGCATC[C/T]
CATAAACGACTCCATCTCCATCACTCCATCCGATGCAACGCCACGCTGATCTGCGACGACGACGACGCCGACGCCGACGGGCCGTTCCGCGTGGCCGCCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.50% | 6.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 80.80% | 19.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 69.40% | 30.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 86.30% | 13.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1002718424 | G -> A | LOC_Os10g05500.1 | synonymous_variant ; p.Ser158Ser; LOW | synonymous_codon | Average:73.758; most accessible tissue: Zhenshan97 young leaf, score: 90.078 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1002718424 | NA | 1.22E-07 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002718424 | NA | 3.75E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002718424 | NA | 7.52E-06 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002718424 | 2.08E-06 | 2.07E-06 | mr1736 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002718424 | NA | 4.45E-06 | mr1736 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002718424 | NA | 2.41E-06 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002718424 | NA | 2.29E-07 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002718424 | NA | 1.74E-06 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |