Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002659326:

Variant ID: vg1002659326 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2659326
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATGGCATCTCGCTAAACTATTTTTCAAGACAAAGCTAGCTAGGCTGATCATATTAAATCTATACTTTCTATAAAGTTAAAATTAAAATGGACTAAGTCT[A/G]
AAGCTCAACATACAACCATGCCGCATCGTCAGCCACTAGCAATAATTACATATTTAATCTCATGCAAGTATACAACATGATCTACAATTTATTTAATTCT

Reverse complement sequence

AGAATTAAATAAATTGTAGATCATGTTGTATACTTGCATGAGATTAAATATGTAATTATTGCTAGTGGCTGACGATGCGGCATGGTTGTATGTTGAGCTT[T/C]
AGACTTAGTCCATTTTAATTTTAACTTTATAGAAAGTATAGATTTAATATGATCAGCCTAGCTAGCTTTGTCTTGAAAAATAGTTTAGCGAGATGCCATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.90%	40.50%	0.13%	3.43%	NA
All Indica	2759	91.40%	8.30%	0.04%	0.29%	NA
All Japonica	1512	5.40%	85.30%	0.26%	9.06%	NA
Aus	269	0.70%	96.30%	0.37%	2.60%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	85.50%	13.70%	0.11%	0.66%	NA
Indica Intermediate	786	88.40%	11.30%	0.00%	0.25%	NA
Temperate Japonica	767	7.00%	80.40%	0.39%	12.13%	NA
Tropical Japonica	504	3.20%	93.10%	0.20%	3.57%	NA
Japonica Intermediate	241	5.00%	84.20%	0.00%	10.79%	NA
VI/Aromatic	96	2.10%	89.60%	0.00%	8.33%	NA
Intermediate	90	41.10%	56.70%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002659326	A -> G	LOC_Os10g05380.1	upstream_gene_variant ; 4901.0bp to feature; MODIFIER	silent_mutation	Average:41.901; most accessible tissue: Callus, score: 62.198	N	N	N	N
vg1002659326	A -> G	LOC_Os10g05400.1	upstream_gene_variant ; 2985.0bp to feature; MODIFIER	silent_mutation	Average:41.901; most accessible tissue: Callus, score: 62.198	N	N	N	N
vg1002659326	A -> G	LOC_Os10g05390.1	downstream_gene_variant ; 919.0bp to feature; MODIFIER	silent_mutation	Average:41.901; most accessible tissue: Callus, score: 62.198	N	N	N	N
vg1002659326	A -> G	LOC_Os10g05390-LOC_Os10g05400	intergenic_region ; MODIFIER	silent_mutation	Average:41.901; most accessible tissue: Callus, score: 62.198	N	N	N	N
vg1002659326	A -> DEL	N	N	silent_mutation	Average:41.901; most accessible tissue: Callus, score: 62.198	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002659326	1.77E-07	1.77E-07	mr1098	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002659326	2.99E-06	2.99E-06	mr1099	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002659326	NA	7.00E-07	mr1101	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002659326	NA	5.61E-06	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002659326	5.18E-06	8.92E-07	mr1150	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002659326	NA	2.78E-14	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002659326	NA	5.90E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002659326	NA	7.13E-06	mr1858	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002659326	NA	7.13E-06	mr1859	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002659326	NA	7.99E-08	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002659326	NA	8.35E-13	mr1666_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002659326	NA	5.14E-10	mr1761_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002659326	NA	5.09E-06	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251