\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002656443:

Variant ID: vg1002656443 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2656443
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGGCCGTCCCCCGCCCAGATCCAGCGGTGGCTGGCCAGCAGGCGTTTTGCTATTTTTATTTTTGTGTGTGGACGACATAAACATCCGCACACGGAAATC[C/T]
GATTTTCGCATGTGGGTGCGCCACCCTCATAGAAAAATAGAGATTTTCATAGACATTTCTGGGCAAACGGCCCGGAGGTCCGCAAGCAAAAATCACTTTT

Reverse complement sequence

AAAAGTGATTTTTGCTTGCGGACCTCCGGGCCGTTTGCCCAGAAATGTCTATGAAAATCTCTATTTTTCTATGAGGGTGGCGCACCCACATGCGAAAATC[G/A]
GATTTCCGTGTGCGGATGTTTATGTCGTCCACACACAAAAATAAAAATAGCAAAACGCCTGCTGGCCAGCCACCGCTGGATCTGGGCGGGGGACGGCCAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.90% 40.40% 0.23% 3.47% NA
All Indica  2759 91.30% 8.20% 0.14% 0.36% NA
All Japonica  1512 5.50% 85.10% 0.46% 8.99% NA
Aus  269 0.70% 96.30% 0.00% 2.97% NA
Indica I  595 99.00% 0.50% 0.50% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 85.90% 13.30% 0.00% 0.88% NA
Indica Intermediate  786 88.20% 11.50% 0.13% 0.25% NA
Temperate Japonica  767 7.40% 79.90% 0.65% 11.99% NA
Tropical Japonica  504 3.00% 93.50% 0.00% 3.57% NA
Japonica Intermediate  241 4.60% 83.80% 0.83% 10.79% NA
VI/Aromatic  96 3.10% 88.50% 0.00% 8.33% NA
Intermediate  90 40.00% 57.80% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002656443 C -> T LOC_Os10g05380.1 upstream_gene_variant ; 2018.0bp to feature; MODIFIER silent_mutation Average:62.798; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 N N N N
vg1002656443 C -> T LOC_Os10g05390.1 upstream_gene_variant ; 904.0bp to feature; MODIFIER silent_mutation Average:62.798; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 N N N N
vg1002656443 C -> T LOC_Os10g05380-LOC_Os10g05390 intergenic_region ; MODIFIER silent_mutation Average:62.798; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 N N N N
vg1002656443 C -> DEL N N silent_mutation Average:62.798; most accessible tissue: Zhenshan97 flag leaf, score: 75.455 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002656443 2.55E-06 NA mr1942 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002656443 NA 7.77E-06 mr1968 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002656443 NA 7.34E-08 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002656443 NA 3.17E-12 mr1666_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002656443 NA 4.37E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251