\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002637184:

Variant ID: vg1002637184 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2637184
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGATTTTTTTTACTACGTCACATATAATTCCTTTTTCTTTAGAATCAGACAGTTTTTTTAACTGCGTCATCTGAGTCGGATTCGTTTCGATTTTTTTCCT[C/A]
TTTTTACCCCGCTTTTTTTGATCGAACAGATTTGTTATTTTTCGCCCGTGTTTTTTTTTTCGCCCCGTTTTTTTATCGGACTTTTTTTTTCTTTTTTTCG

Reverse complement sequence

CGAAAAAAAGAAAAAAAAAGTCCGATAAAAAAACGGGGCGAAAAAAAAAACACGGGCGAAAAATAACAAATCTGTTCGATCAAAAAAAGCGGGGTAAAAA[G/T]
AGGAAAAAAATCGAAACGAATCCGACTCAGATGACGCAGTTAAAAAAACTGTCTGATTCTAAAGAAAAAGGAATTATATGTGACGTAGTAAAAAAAATCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.80% 29.90% 0.99% 13.25% NA
All Indica  2759 91.40% 7.10% 1.09% 0.43% NA
All Japonica  1512 4.90% 55.00% 0.40% 39.68% NA
Aus  269 0.70% 96.70% 2.23% 0.37% NA
Indica I  595 99.70% 0.20% 0.00% 0.17% NA
Indica II  465 97.60% 1.70% 0.00% 0.65% NA
Indica III  913 85.30% 11.40% 2.74% 0.55% NA
Indica Intermediate  786 88.40% 10.60% 0.64% 0.38% NA
Temperate Japonica  767 6.00% 38.50% 0.52% 55.02% NA
Tropical Japonica  504 3.00% 87.30% 0.00% 9.72% NA
Japonica Intermediate  241 5.40% 40.20% 0.83% 53.53% NA
VI/Aromatic  96 2.10% 87.50% 4.17% 6.25% NA
Intermediate  90 44.40% 46.70% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002637184 C -> A LOC_Os10g05340.1 upstream_gene_variant ; 3138.0bp to feature; MODIFIER silent_mutation Average:29.194; most accessible tissue: Callus, score: 44.385 N N N N
vg1002637184 C -> A LOC_Os10g05340-LOC_Os10g05360 intergenic_region ; MODIFIER silent_mutation Average:29.194; most accessible tissue: Callus, score: 44.385 N N N N
vg1002637184 C -> DEL N N silent_mutation Average:29.194; most accessible tissue: Callus, score: 44.385 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002637184 NA 1.42E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002637184 NA 2.17E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002637184 NA 6.96E-08 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002637184 NA 2.16E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002637184 NA 5.64E-07 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002637184 NA 3.95E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002637184 NA 3.03E-06 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002637184 NA 4.30E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002637184 3.42E-06 2.00E-08 mr1603 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002637184 NA 9.35E-08 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002637184 NA 4.42E-09 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002637184 NA 2.89E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002637184 NA 2.14E-08 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002637184 NA 9.31E-06 mr1782 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002637184 NA 7.88E-07 mr1796 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002637184 NA 1.95E-18 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002637184 NA 5.34E-08 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002637184 NA 1.79E-06 mr1912 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002637184 NA 7.62E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002637184 NA 6.97E-07 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002637184 NA 1.54E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002637184 NA 5.24E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251