\
| Variant ID: vg1002594715 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 2594715 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AAAATGTAGTCAGGCTAATTGGCTACTGCATCGAGAAAAATGCTCCAATGATGGTCATGGAGTATGTGCCTAATAGGGACCTTGATTACCATCTTCATGA[C/G]
AAGAATAGCCTTGATTCATTGGACATAAGATTGGATATTGCTATAGAGTGTGCAGATGCTCTAGGGTATTTACATTCTATGTGCAGCCCTGTTCTACATG
CATGTAGAACAGGGCTGCACATAGAATGTAAATACCCTAGAGCATCTGCACACTCTATAGCAATATCCAATCTTATGTCCAATGAATCAAGGCTATTCTT[G/C]
TCATGAAGATGGTAATCAAGGTCCCTATTAGGCACATACTCCATGACCATCATTGGAGCATTTTTCTCGATGCAGTAGCCAATTAGCCTGACTACATTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.30% | 4.50% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 86.20% | 13.60% | 0.20% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 79.50% | 20.10% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.60% | 12.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 1.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1002594715 | C -> G | LOC_Os10g05250.1 | missense_variant ; p.Asp123Glu; MODERATE | nonsynonymous_codon ; D123V | Average:51.722; most accessible tissue: Callus, score: 88.03 | benign |
0.136 |
TOLERATED | 0.40 |
| vg1002594715 | C -> G | LOC_Os10g05250.1 | missense_variant ; p.Asp123Glu; MODERATE | nonsynonymous_codon ; D123E | Average:51.722; most accessible tissue: Callus, score: 88.03 | benign |
1.097 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1002594715 | 1.55E-07 | NA | mr1062 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002594715 | 9.84E-06 | 2.15E-09 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002594715 | 5.36E-06 | 5.36E-06 | mr1166 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002594715 | NA | 2.68E-08 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002594715 | NA | 1.44E-08 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002594715 | 1.23E-06 | 1.23E-06 | mr1409 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002594715 | NA | 1.23E-06 | mr1515 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002594715 | 1.22E-06 | 2.11E-10 | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002594715 | NA | 1.33E-10 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002594715 | NA | 1.17E-07 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002594715 | NA | 3.56E-08 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002594715 | NA | 1.98E-07 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002594715 | 8.56E-06 | 1.05E-11 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002594715 | NA | 1.22E-09 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |