\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002548618:

Variant ID: vg1002548618 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2548618
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAATGCTAAACGGACTTCCATCCAATTTTATTAAATTTTTTTTGAGGTGGGGGGTATTTGGACTTTCTCCTTTGTAGTATCATAGGATCGAGATACTAC[C/T]
ATAGGATCGGGATTCAAGATACTATCAGATTTTTAAAAATACATATTTTATATAAAATATATAATATGTTGTATAAATTAAATAATATAATATTGGTTTT

Reverse complement sequence

AAAACCAATATTATATTATTTAATTTATACAACATATTATATATTTTATATAAAATATGTATTTTTAAAAATCTGATAGTATCTTGAATCCCGATCCTAT[G/A]
GTAGTATCTCGATCCTATGATACTACAAAGGAGAAAGTCCAAATACCCCCCACCTCAAAAAAAATTTAATAAAATTGGATGGAAGTCCGTTTAGCATTCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.10% 18.50% 0.06% 1.40% NA
All Indica  2759 99.20% 0.80% 0.00% 0.00% NA
All Japonica  1512 41.10% 54.30% 0.20% 4.37% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 98.30% 1.70% 0.00% 0.00% NA
Temperate Japonica  767 11.20% 79.90% 0.39% 8.47% NA
Tropical Japonica  504 89.50% 10.50% 0.00% 0.00% NA
Japonica Intermediate  241 35.30% 64.30% 0.00% 0.41% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002548618 C -> T LOC_Os10g05200.1 upstream_gene_variant ; 764.0bp to feature; MODIFIER silent_mutation Average:28.138; most accessible tissue: Callus, score: 42.812 N N N N
vg1002548618 C -> T LOC_Os10g05190.1 downstream_gene_variant ; 3777.0bp to feature; MODIFIER silent_mutation Average:28.138; most accessible tissue: Callus, score: 42.812 N N N N
vg1002548618 C -> T LOC_Os10g05190-LOC_Os10g05200 intergenic_region ; MODIFIER silent_mutation Average:28.138; most accessible tissue: Callus, score: 42.812 N N N N
vg1002548618 C -> DEL N N silent_mutation Average:28.138; most accessible tissue: Callus, score: 42.812 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002548618 NA 1.92E-06 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 4.39E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 6.20E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 1.61E-07 mr1118 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 1.21E-06 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 1.56E-15 mr1156 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 9.15E-06 mr1220 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 1.99E-08 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 8.61E-07 1.01E-26 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 9.94E-06 1.56E-41 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 3.24E-06 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 7.73E-07 mr1425 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 3.04E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 9.04E-07 3.20E-07 mr1482 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 1.91E-07 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 1.02E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 9.99E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 2.85E-15 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 2.38E-11 mr1580 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 4.28E-08 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 9.76E-24 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 4.09E-11 mr1679 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 5.80E-09 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 2.36E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 5.77E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 4.98E-16 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 2.86E-06 2.86E-06 mr1736 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 1.90E-08 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 8.21E-14 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 2.19E-06 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 8.42E-20 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 7.04E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 3.65E-10 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 1.09E-09 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 5.60E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 7.47E-06 mr1912 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 3.61E-06 5.31E-46 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 1.83E-06 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 1.87E-11 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 1.43E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 4.22E-07 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 5.94E-06 mr1123_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 6.95E-07 1.55E-39 mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 5.96E-08 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 6.17E-08 mr1495_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 3.75E-23 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 2.62E-08 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 3.53E-06 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002548618 NA 5.23E-17 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251