\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002425054:

Variant ID: vg1002425054 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2425054
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACAATTACAAAAGGAGAAGATTTTTTATAAAAACAAACAATTGTTACAATGTATGTCCTGTTTATACGTAGTACGGGTTGATCATTAATTCTGACTAGT[G/C]
AATTATCAGCGTGTCGTAACTCATAATTAATTGATTTATAGTCAAATTTTTTAAAGTTTGGTATATATCAGCCAAGTTCAAAACAACAATTATTTTCAAC

Reverse complement sequence

GTTGAAAATAATTGTTGTTTTGAACTTGGCTGATATATACCAAACTTTAAAAAATTTGACTATAAATCAATTAATTATGAGTTACGACACGCTGATAATT[C/G]
ACTAGTCAGAATTAATGATCAACCCGTACTACGTATAAACAGGACATACATTGTAACAATTGTTTGTTTTTATAAAAAATCTTCTCCTTTTGTAATTGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.10% 0.30% 6.88% 6.67% NA
All Indica  2759 96.60% 0.00% 1.99% 1.34% NA
All Japonica  1512 77.10% 0.30% 11.77% 10.85% NA
Aus  269 47.60% 1.90% 25.65% 24.91% NA
Indica I  595 96.80% 0.00% 3.19% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 96.90% 0.00% 1.42% 1.64% NA
Indica Intermediate  786 94.10% 0.10% 2.93% 2.80% NA
Temperate Japonica  767 92.30% 0.00% 3.39% 4.30% NA
Tropical Japonica  504 53.00% 0.80% 25.79% 20.44% NA
Japonica Intermediate  241 78.80% 0.40% 9.13% 11.62% NA
VI/Aromatic  96 45.80% 2.10% 13.54% 38.54% NA
Intermediate  90 75.60% 2.20% 11.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002425054 G -> C LOC_Os10g04980.1 intron_variant ; MODIFIER silent_mutation Average:51.898; most accessible tissue: Callus, score: 73.778 N N N N
vg1002425054 G -> DEL N N silent_mutation Average:51.898; most accessible tissue: Callus, score: 73.778 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002425054 NA 2.59E-08 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002425054 NA 6.51E-06 mr1029 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002425054 NA 8.30E-06 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002425054 NA 6.63E-07 mr1042 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002425054 9.54E-06 9.53E-06 mr1043 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002425054 NA 1.12E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002425054 NA 8.29E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002425054 NA 4.36E-06 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002425054 NA 3.30E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002425054 NA 5.31E-07 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002425054 NA 5.37E-06 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002425054 4.62E-06 4.62E-06 mr1479 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002425054 NA 1.06E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002425054 NA 5.87E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002425054 NA 2.15E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002425054 NA 6.81E-07 mr1588 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002425054 NA 3.76E-08 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002425054 NA 2.86E-06 mr1625 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002425054 NA 1.34E-07 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002425054 NA 4.07E-08 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002425054 NA 3.56E-07 mr1912 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251