\
| Variant ID: vg1002424810 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 2424810 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CAATATATAGTCTGCTTAAAAACAAAAACAGTGTAAGCACATGCGTGAGAATTAATATTGAATGTTACTGTTTCCAATAACAAACGATAAGCATTTGCAA[A/G]
AATACTTTGCAGCGCCATCCGTATTTAATAAGGTACAAATAAGAACACATGGTTTAGGTTCATTGAGTTTATCAAACAGAAATTTTCATGTCAAATTCCA
TGGAATTTGACATGAAAATTTCTGTTTGATAAACTCAATGAACCTAAACCATGTGTTCTTATTTGTACCTTATTAAATACGGATGGCGCTGCAAAGTATT[T/C]
TTGCAAATGCTTATCGTTTGTTATTGGAAACAGTAACATTCAATATTAATTCTCACGCATGTGCTTACACTGTTTTTGTTTTTAAGCAGACTATATATTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.40% | 22.50% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 93.60% | 6.30% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 1.10% | 98.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 92.00% | 7.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 90.70% | 9.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 89.80% | 10.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 31.00% | 69.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 67.60% | 32.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 12.50% | 87.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 41.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1002424810 | A -> G | LOC_Os10g04980.1 | intron_variant ; MODIFIER | silent_mutation | Average:31.976; most accessible tissue: Callus, score: 69.669 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1002424810 | NA | 3.13E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002424810 | NA | 6.77E-07 | mr1042 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002424810 | 2.60E-06 | 2.59E-06 | mr1043 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002424810 | NA | 6.15E-08 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002424810 | NA | 1.02E-07 | mr1179 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002424810 | NA | 7.55E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002424810 | NA | 2.16E-07 | mr1194 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002424810 | NA | 1.68E-06 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002424810 | NA | 9.76E-06 | mr1295 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002424810 | NA | 1.33E-06 | mr1502 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002424810 | NA | 7.31E-06 | mr1588 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002424810 | NA | 1.62E-06 | mr1625 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002424810 | NA | 1.24E-07 | mr1736 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002424810 | NA | 1.47E-06 | mr1912 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |