Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002406098:

Variant ID: vg1002406098 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2406098
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCTGCTGCTCCTTCTCGCCGTCAACAACATCGACAGAACAACATTGATCTCGGCCATGGTGATCAGGGGCTAGCTCAGATGACAACGAACTCGATCCGA[C/T]
GAGTGATAGTTGCTGGAAAGCGATCGAGTTTGGTGAGGGTGAAGTGAAGAGCACAGAGATGGATATAAATCAAGAGGACGAGAGTGATGGGTGCCGTGAC

Reverse complement sequence

GTCACGGCACCCATCACTCTCGTCCTCTTGATTTATATCCATCTCTGTGCTCTTCACTTCACCCTCACCAAACTCGATCGCTTTCCAGCAACTATCACTC[G/A]
TCGGATCGAGTTCGTTGTCATCTGAGCTAGCCCCTGATCACCATGGCCGAGATCAATGTTGTTCTGTCGATGTTGTTGACGGCGAGAAGGAGCAGCAGCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.60%	20.00%	0.76%	0.68%	NA
All Indica	2759	94.40%	5.20%	0.33%	0.07%	NA
All Japonica	1512	67.70%	31.50%	0.73%	0.00%	NA
Aus	269	3.30%	88.10%	4.09%	4.46%	NA
Indica I	595	97.50%	2.00%	0.50%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	92.80%	7.00%	0.11%	0.11%	NA
Indica Intermediate	786	91.10%	8.10%	0.64%	0.13%	NA
Temperate Japonica	767	90.10%	9.80%	0.13%	0.00%	NA
Tropical Japonica	504	33.30%	64.90%	1.79%	0.00%	NA
Japonica Intermediate	241	68.50%	31.10%	0.41%	0.00%	NA
VI/Aromatic	96	16.70%	61.50%	5.21%	16.67%	NA
Intermediate	90	66.70%	31.10%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002406098	C -> T	LOC_Os10g04910.1	upstream_gene_variant ; 1683.0bp to feature; MODIFIER	silent_mutation	Average:64.788; most accessible tissue: Zhenshan97 young leaf, score: 81.102	N	N	N	N
vg1002406098	C -> T	LOC_Os10g04930.1	downstream_gene_variant ; 2596.0bp to feature; MODIFIER	silent_mutation	Average:64.788; most accessible tissue: Zhenshan97 young leaf, score: 81.102	N	N	N	N
vg1002406098	C -> T	LOC_Os10g04910-LOC_Os10g04930	intergenic_region ; MODIFIER	silent_mutation	Average:64.788; most accessible tissue: Zhenshan97 young leaf, score: 81.102	N	N	N	N
vg1002406098	C -> DEL	N	N	silent_mutation	Average:64.788; most accessible tissue: Zhenshan97 young leaf, score: 81.102	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002406098	NA	5.46E-06	mr1040	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002406098	NA	1.05E-06	mr1042	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002406098	6.08E-06	6.08E-06	mr1043	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002406098	NA	8.19E-06	mr1044	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002406098	NA	1.28E-07	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002406098	NA	3.11E-07	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002406098	NA	8.92E-08	mr1194	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002406098	NA	1.60E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002406098	NA	5.83E-06	mr1295	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002406098	7.27E-06	7.27E-06	mr1385	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002406098	NA	5.18E-06	mr1482	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002406098	NA	4.15E-06	mr1588	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002406098	NA	3.84E-09	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002406098	NA	6.16E-09	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002406098	NA	1.20E-07	mr1912	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002406098	NA	2.65E-06	mr1982	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251