\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002389961:

Variant ID: vg1002389961 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2389961
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTAAGCAATTGTCATAATTGACTAGAGACTCATACGTAAACATGGTTACGAAGGCATAAGGGTAAACAATAATCAAGGCATGGCATAATCACAAGTAG[A/G]
ATGTTCATCATTGCATGCAATTTTATTTGTAAACAAAATAATTTCGCAATTAGGATCAACATGTTCAAAGAATAGTGATGACTTGCCTTGCTCGTAGTCC

Reverse complement sequence

GGACTACGAGCAAGGCAAGTCATCACTATTCTTTGAACATGTTGATCCTAATTGCGAAATTATTTTGTTTACAAATAAAATTGCATGCAATGATGAACAT[T/C]
CTACTTGTGATTATGCCATGCCTTGATTATTGTTTACCCTTATGCCTTCGTAACCATGTTTACGTATGAGTCTCTAGTCAATTATGACAATTGCTTAGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.40% 22.10% 0.49% 0.00% NA
All Indica  2759 98.10% 1.40% 0.54% 0.00% NA
All Japonica  1512 35.10% 64.70% 0.13% 0.00% NA
Aus  269 97.40% 1.10% 1.49% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 97.60% 0.90% 1.53% 0.00% NA
Indica Intermediate  786 98.30% 1.50% 0.13% 0.00% NA
Temperate Japonica  767 11.20% 88.80% 0.00% 0.00% NA
Tropical Japonica  504 72.20% 27.80% 0.00% 0.00% NA
Japonica Intermediate  241 33.60% 65.60% 0.83% 0.00% NA
VI/Aromatic  96 88.50% 9.40% 2.08% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002389961 A -> G LOC_Os10g04900.2 downstream_gene_variant ; 2120.0bp to feature; MODIFIER silent_mutation Average:17.29; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N
vg1002389961 A -> G LOC_Os10g04900.1 intron_variant ; MODIFIER silent_mutation Average:17.29; most accessible tissue: Zhenshan97 panicle, score: 28.447 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002389961 NA 3.63E-06 mr1029 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 6.92E-07 mr1040 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 8.82E-06 mr1042 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 2.32E-07 mr1044 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 4.70E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 5.70E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 4.08E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 5.32E-07 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 1.93E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 5.16E-08 mr1194 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 3.07E-07 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 5.71E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 1.70E-06 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 2.68E-06 3.06E-07 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 8.65E-07 mr1482 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 6.79E-07 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 3.53E-06 mr1588 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 3.28E-06 3.28E-06 mr1621 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 2.61E-06 mr1625 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 8.53E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 3.20E-06 3.21E-06 mr1736 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 3.24E-09 mr1736 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 2.39E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 1.10E-19 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 6.04E-08 mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 8.29E-06 mr1912 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 1.08E-09 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 1.69E-06 1.69E-06 mr1981 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 1.18E-16 mr1982 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 5.54E-07 mr1982 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002389961 NA 1.32E-13 mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251