Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1002370671:

Variant ID: vg1002370671 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2370671
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.20, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

AGAGAGATAGAGAGAGAGAGAGAGGGGAGGGGGAGGGAGGAAGAGGGGAAGAGGAGGTACAGGACCATGCTGACGCCCGGTCGGCCTCCATCTCCGTTGC[C/T]
GACCGCCCGATCCGCCTCCACCGCCGGCCACCAAGCTCCTCTCCCCATCTCTCTCATCCTTCTCTCCTCACGGTGTGGAGAGGCCCTCCCTTCGCCGGCG

Reverse complement sequence

CGCCGGCGAAGGGAGGGCCTCTCCACACCGTGAGGAGAGAAGGATGAGAGAGATGGGGAGAGGAGCTTGGTGGCCGGCGGTGGAGGCGGATCGGGCGGTC[G/A]
GCAACGGAGATGGAGGCCGACCGGGCGTCAGCATGGTCCTGTACCTCCTCTTCCCCTCTTCCTCCCTCCCCCTCCCCTCTCTCTCTCTCTCTATCTCTCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.30%	41.00%	0.36%	7.34%	NA
All Indica	2759	54.80%	44.70%	0.25%	0.18%	NA
All Japonica	1512	34.10%	43.20%	0.46%	22.29%	NA
Aus	269	97.00%	2.60%	0.37%	0.00%	NA
Indica I	595	37.10%	62.50%	0.17%	0.17%	NA
Indica II	465	35.70%	63.20%	0.43%	0.65%	NA
Indica III	913	79.00%	20.90%	0.11%	0.00%	NA
Indica Intermediate	786	51.50%	48.00%	0.38%	0.13%	NA
Temperate Japonica	767	10.80%	51.20%	0.78%	37.16%	NA
Tropical Japonica	504	69.60%	29.40%	0.00%	0.99%	NA
Japonica Intermediate	241	33.60%	46.50%	0.41%	19.50%	NA
VI/Aromatic	96	86.50%	12.50%	1.04%	0.00%	NA
Intermediate	90	58.90%	34.40%	1.11%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002370671	C -> T	LOC_Os10g04890.1	upstream_gene_variant ; 3944.0bp to feature; MODIFIER	silent_mutation	Average:81.817; most accessible tissue: Minghui63 young leaf, score: 90.17	N	N	N	N
vg1002370671	C -> T	LOC_Os10g04890.2	upstream_gene_variant ; 3944.0bp to feature; MODIFIER	silent_mutation	Average:81.817; most accessible tissue: Minghui63 young leaf, score: 90.17	N	N	N	N
vg1002370671	C -> T	LOC_Os10g04860.1	downstream_gene_variant ; 1939.0bp to feature; MODIFIER	silent_mutation	Average:81.817; most accessible tissue: Minghui63 young leaf, score: 90.17	N	N	N	N
vg1002370671	C -> T	LOC_Os10g04870.1	downstream_gene_variant ; 347.0bp to feature; MODIFIER	silent_mutation	Average:81.817; most accessible tissue: Minghui63 young leaf, score: 90.17	N	N	N	N
vg1002370671	C -> T	LOC_Os10g04880.1	downstream_gene_variant ; 1511.0bp to feature; MODIFIER	silent_mutation	Average:81.817; most accessible tissue: Minghui63 young leaf, score: 90.17	N	N	N	N
vg1002370671	C -> T	LOC_Os10g04870-LOC_Os10g04880	intergenic_region ; MODIFIER	silent_mutation	Average:81.817; most accessible tissue: Minghui63 young leaf, score: 90.17	N	N	N	N
vg1002370671	C -> DEL	N	N	silent_mutation	Average:81.817; most accessible tissue: Minghui63 young leaf, score: 90.17	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1002370671	C	T	-0.04	-0.02	-0.05	-0.05	-0.06	-0.06

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002370671	NA	6.52E-07	mr1040	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002370671	NA	1.59E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002370671	NA	5.14E-07	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002370671	NA	1.16E-07	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002370671	NA	1.13E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002370671	NA	5.10E-06	mr1295	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002370671	NA	1.59E-06	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002370671	NA	2.99E-06	mr1482	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002370671	3.63E-06	NA	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002370671	2.15E-06	2.15E-06	mr1520	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002370671	NA	4.58E-06	mr1588	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002370671	NA	3.63E-08	mr1624	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002370671	NA	6.25E-07	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002370671	NA	2.37E-06	mr1780	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002370671	NA	9.36E-08	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002370671	3.05E-06	5.62E-06	mr1836	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002370671	NA	4.94E-07	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002370671	NA	7.54E-07	mr1982	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251