\
| Variant ID: vg1002299754 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 2299754 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.06, others allele: 0.00, population size: 259. )
ATTCTTCAGCTCATACGTCTTCTGCAGCACCCACTTGGCAACACCTCCAGAACAGACTTTCCTCTCCCACATTTGAAGGCTGCTGCGAGACAAAGTGGCG[G/A]
CGCCAAGACAATCACCTTCTGTCAGCCAGGTCTGACTGTATGGCTCGGAATCGTAGGGCCATTCAATCACGCTGAGGGTTTGCTTATCCAAATCAAACTG
CAGTTTGATTTGGATAAGCAAACCCTCAGCGTGATTGAATGGCCCTACGATTCCGAGCCATACAGTCAGACCTGGCTGACAGAAGGTGATTGTCTTGGCG[C/T]
CGCCACTTTGTCTCGCAGCAGCCTTCAAATGTGGGAGAGGAAAGTCTGTTCTGGAGGTGTTGCCAAGTGGGTGCTGCAGAAGACGTATGAGCTGAAGAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.80% | 34.70% | 0.21% | 0.30% | NA |
| All Indica | 2759 | 59.70% | 39.50% | 0.33% | 0.47% | NA |
| All Japonica | 1512 | 84.70% | 15.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 14.50% | 85.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 69.70% | 29.70% | 0.17% | 0.34% | NA |
| Indica II | 465 | 65.60% | 32.90% | 0.43% | 1.08% | NA |
| Indica III | 913 | 51.50% | 48.20% | 0.22% | 0.11% | NA |
| Indica Intermediate | 786 | 58.10% | 40.70% | 0.51% | 0.64% | NA |
| Temperate Japonica | 767 | 91.50% | 8.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 78.00% | 22.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 76.80% | 23.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 45.80% | 54.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 37.80% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1002299754 | G -> A | LOC_Os10g04780.1 | missense_variant ; p.Ala273Val; MODERATE | nonsynonymous_codon ; A273V | Average:78.54; most accessible tissue: Minghui63 flag leaf, score: 84.791 | unknown | unknown | TOLERATED | 0.27 |
| vg1002299754 | G -> DEL | LOC_Os10g04780.1 | N | frameshift_variant | Average:78.54; most accessible tissue: Minghui63 flag leaf, score: 84.791 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1002299754 | NA | 7.56E-06 | mr1179 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002299754 | 8.90E-08 | NA | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002299754 | NA | 4.96E-09 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002299754 | NA | 1.51E-08 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002299754 | 2.16E-07 | NA | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002299754 | NA | 1.69E-07 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002299754 | NA | 7.82E-08 | mr1588 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002299754 | NA | 4.64E-11 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002299754 | NA | 3.95E-08 | mr1624 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002299754 | 7.78E-06 | NA | mr1751 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002299754 | 3.45E-06 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002299754 | NA | 1.18E-07 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002299754 | NA | 7.93E-07 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |