\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002298537:

Variant ID: vg1002298537 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2298537
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGAGGAACAATTGAATTATTGGAACTATTCTCGAAGTTTGGCTACATCTATCTAGCAACAAAAGGTTTACTACTTCACTGCCTCATTTTGGCAGATGAG[A/G]
GGCACAACCACACATAGCAGGTAGAAAGTAGAAACACCTGTTTCTAGTTCATATGTATACTTTTAAATATTTAAGAACCAATCAGTAATTACTATGTTCA

Reverse complement sequence

TGAACATAGTAATTACTGATTGGTTCTTAAATATTTAAAAGTATACATATGAACTAGAAACAGGTGTTTCTACTTTCTACCTGCTATGTGTGGTTGTGCC[T/C]
CTCATCTGCCAAAATGAGGCAGTGAAGTAGTAAACCTTTTGTTGCTAGATAGATGTAGCCAAACTTCGAGAATAGTTCCAATAATTCAATTGTTCCTCTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.30% 21.50% 1.67% 10.54% NA
All Indica  2759 61.60% 24.60% 1.99% 11.82% NA
All Japonica  1512 85.00% 9.10% 0.66% 5.29% NA
Aus  269 16.00% 50.60% 4.09% 29.37% NA
Indica I  595 71.30% 14.10% 1.34% 13.28% NA
Indica II  465 68.00% 18.90% 1.72% 11.40% NA
Indica III  913 52.90% 34.00% 1.86% 11.28% NA
Indica Intermediate  786 60.70% 24.90% 2.80% 11.58% NA
Temperate Japonica  767 91.70% 4.70% 0.39% 3.26% NA
Tropical Japonica  504 78.60% 14.10% 0.99% 6.35% NA
Japonica Intermediate  241 77.20% 12.40% 0.83% 9.54% NA
VI/Aromatic  96 47.90% 47.90% 2.08% 2.08% NA
Intermediate  90 63.30% 23.30% 1.11% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002298537 A -> G LOC_Os10g04780.1 downstream_gene_variant ; 901.0bp to feature; MODIFIER silent_mutation Average:33.178; most accessible tissue: Callus, score: 71.14 N N N N
vg1002298537 A -> G LOC_Os10g04770-LOC_Os10g04780 intergenic_region ; MODIFIER silent_mutation Average:33.178; most accessible tissue: Callus, score: 71.14 N N N N
vg1002298537 A -> DEL N N silent_mutation Average:33.178; most accessible tissue: Callus, score: 71.14 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002298537 2.59E-07 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002298537 NA 1.86E-08 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002298537 NA 2.97E-08 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002298537 9.06E-07 NA mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002298537 NA 5.10E-07 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002298537 NA 3.54E-07 mr1588 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002298537 NA 3.33E-09 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002298537 NA 3.17E-06 mr1624 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002298537 1.25E-06 NA mr1751 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002298537 NA 9.67E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002298537 NA 3.55E-07 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002298537 NA 1.54E-06 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251