Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1002292707:

Variant ID: vg1002292707 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2292707
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.02, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GTCGCCGGTGTCGGGGTCCCAGAGGACGATCTCGTTCTGCTTCCGGTCCAGGAGGAGGACGCGGCCATGGCGGCATCCGCAGAACATCCGCTCTTTGCGG[A/C]
CCTCGTCCTCGCCGAGCCGCATCGAGAAGCGCTCCCTTGGGATGAGATCCCGCGGATCCATCACGGACCGGAAGAAGGGGAAGCCGAAGTCGTCGGCAAA

Reverse complement sequence

TTTGCCGACGACTTCGGCTTCCCCTTCTTCCGGTCCGTGATGGATCCGCGGGATCTCATCCCAAGGGAGCGCTTCTCGATGCGGCTCGGCGAGGACGAGG[T/G]
CCGCAAAGAGCGGATGTTCTGCGGATGCCGCCATGGCCGCGTCCTCCTCCTGGACCGGAAGCAGAACGAGATCGTCCTCTGGGACCCCGACACCGGCGAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 34.70% 0.13% 0.95% NA
All Indica  2759 59.50% 39.60% 0.18% 0.69% NA
All Japonica  1512 84.70% 15.30% 0.00% 0.00% NA
Aus  269 6.30% 85.90% 0.00% 7.81% NA
Indica I  595 69.60% 29.90% 0.17% 0.34% NA
Indica II  465 65.60% 33.10% 0.22% 1.08% NA
Indica III  913 51.30% 48.30% 0.11% 0.33% NA
Indica Intermediate  786 57.90% 40.70% 0.25% 1.15% NA
Temperate Japonica  767 91.50% 8.50% 0.00% 0.00% NA
Tropical Japonica  504 78.00% 22.00% 0.00% 0.00% NA
Japonica Intermediate  241 76.80% 23.20% 0.00% 0.00% NA
VI/Aromatic  96 42.70% 54.20% 0.00% 3.12% NA
Intermediate  90 58.90% 37.80% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002292707 A -> C LOC_Os10g04770.1 missense_variant ; p.Val21Gly; MODERATE nonsynonymous_codon ; V21G Average:85.381; most accessible tissue: Minghui63 panicle, score: 94.558 benign -0.364 TOLERATED 0.36
vg1002292707 A -> DEL LOC_Os10g04770.1 N frameshift_variant Average:85.381; most accessible tissue: Minghui63 panicle, score: 94.558 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1002292707 A C -0.01 -0.01 -0.01 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002292707 1.15E-07 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002292707 NA 1.20E-09 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002292707 NA 4.63E-08 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002292707 1.61E-06 NA mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002292707 NA 4.72E-08 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002292707 3.11E-06 NA mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002292707 NA 1.41E-08 mr1588 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002292707 NA 1.74E-09 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002292707 NA 1.51E-06 mr1624 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002292707 NA 5.12E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002292707 NA 4.53E-08 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002292707 NA 2.23E-06 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002292707 NA 4.75E-06 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251