\
| Variant ID: vg1002291312 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 2291312 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, C: 0.08, others allele: 0.00, population size: 200. )
AAGATAAATATATGTAAACTGAATAAAATTCTAAAAGGAAGCAATATTCCTCCAAACAGTATATTCATAAACCTTGTAACTAGGGGGTGCATAAGTTATC[T/C]
AAAATTATTCTGTGCAAGTAATCACTAGTATGTAAATGGACTAGAGTAATACATCCTGAAGCTAACATAATCTAGTAAAAAATAGAACTTCATTGACCAA
TTGGTCAATGAAGTTCTATTTTTTACTAGATTATGTTAGCTTCAGGATGTATTACTCTAGTCCATTTACATACTAGTGATTACTTGCACAGAATAATTTT[A/G]
GATAACTTATGCACCCCCTAGTTACAAGGTTTATGAATATACTGTTTGGAGGAATATTGCTTCCTTTTAGAATTTTATTCAGTTTACATATATTTATCTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.10% | 32.50% | 0.02% | 0.40% | NA |
| All Indica | 2759 | 60.30% | 39.00% | 0.00% | 0.65% | NA |
| All Japonica | 1512 | 84.70% | 15.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 24.50% | 75.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 69.70% | 29.70% | 0.00% | 0.50% | NA |
| Indica II | 465 | 65.80% | 33.30% | 0.00% | 0.86% | NA |
| Indica III | 913 | 51.90% | 47.80% | 0.00% | 0.33% | NA |
| Indica Intermediate | 786 | 59.70% | 39.30% | 0.00% | 1.02% | NA |
| Temperate Japonica | 767 | 91.50% | 8.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 78.00% | 22.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 77.20% | 22.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 28.90% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1002291312 | T -> C | LOC_Os10g04770.1 | intron_variant ; MODIFIER | silent_mutation | Average:38.044; most accessible tissue: Callus, score: 70.976 | N | N | N | N |
| vg1002291312 | T -> DEL | N | N | silent_mutation | Average:38.044; most accessible tissue: Callus, score: 70.976 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1002291312 | NA | 9.88E-06 | mr1179 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002291312 | 2.71E-08 | NA | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002291312 | NA | 1.91E-09 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002291312 | NA | 1.16E-09 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002291312 | 2.70E-07 | NA | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002291312 | NA | 1.41E-07 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002291312 | 2.44E-06 | NA | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002291312 | NA | 6.41E-08 | mr1588 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002291312 | 1.39E-06 | 3.65E-13 | mr1624 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002291312 | NA | 6.62E-08 | mr1624 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002291312 | 5.62E-06 | NA | mr1751 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002291312 | 2.28E-06 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002291312 | NA | 9.05E-08 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002291312 | NA | 7.92E-10 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002291312 | NA | 3.96E-07 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |