\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002287752:

Variant ID: vg1002287752 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2287752
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, C: 0.04, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


GCTTTAGTGTGAAACATATTGATAAGTATATGTTAAATATTGTAAAAGTGATAAATAGATTTGTTAAAATATAGTGCAAATGACATGAGGGGGTGATGAT[T/C]
GGATATGTTTGCATTTTGATTTGTAGAATTAAATAAATGAGTAAATTTCATAAAACTAAACTACAGATTTTAGAACTAGTTTCATAAAACTACAGATTTA

Reverse complement sequence

TAAATCTGTAGTTTTATGAAACTAGTTCTAAAATCTGTAGTTTAGTTTTATGAAATTTACTCATTTATTTAATTCTACAAATCAAAATGCAAACATATCC[A/G]
ATCATCACCCCCTCATGTCATTTGCACTATATTTTAACAAATCTATTTATCACTTTTACAATATTTAACATATACTTATCAATATGTTTCACACTAAAGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.80% 1.60% 0.74% 61.83% NA
All Indica  2759 12.60% 2.50% 1.23% 83.69% NA
All Japonica  1512 83.50% 0.10% 0.00% 16.40% NA
Aus  269 12.30% 1.90% 0.37% 85.50% NA
Indica I  595 28.60% 5.20% 1.51% 64.71% NA
Indica II  465 2.40% 1.10% 1.08% 95.48% NA
Indica III  913 9.10% 2.70% 0.77% 87.40% NA
Indica Intermediate  786 10.70% 0.90% 1.65% 86.77% NA
Temperate Japonica  767 91.10% 0.00% 0.00% 8.87% NA
Tropical Japonica  504 76.20% 0.00% 0.00% 23.81% NA
Japonica Intermediate  241 74.70% 0.40% 0.00% 24.90% NA
VI/Aromatic  96 14.60% 2.10% 0.00% 83.33% NA
Intermediate  90 38.90% 0.00% 0.00% 61.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002287752 T -> C LOC_Os10g04770.1 downstream_gene_variant ; 1430.0bp to feature; MODIFIER silent_mutation Average:14.939; most accessible tissue: Callus, score: 25.642 N N N N
vg1002287752 T -> C LOC_Os10g04760-LOC_Os10g04770 intergenic_region ; MODIFIER silent_mutation Average:14.939; most accessible tissue: Callus, score: 25.642 N N N N
vg1002287752 T -> DEL N N silent_mutation Average:14.939; most accessible tissue: Callus, score: 25.642 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002287752 1.20E-08 NA mr1486 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002287752 7.30E-06 NA mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002287752 9.73E-07 NA mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002287752 9.66E-06 9.32E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002287752 1.03E-06 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002287752 NA 3.16E-09 mr1709_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251