\
| Variant ID: vg1002287752 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 2287752 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.95, C: 0.04, others allele: 0.00, population size: 80. )
GCTTTAGTGTGAAACATATTGATAAGTATATGTTAAATATTGTAAAAGTGATAAATAGATTTGTTAAAATATAGTGCAAATGACATGAGGGGGTGATGAT[T/C]
GGATATGTTTGCATTTTGATTTGTAGAATTAAATAAATGAGTAAATTTCATAAAACTAAACTACAGATTTTAGAACTAGTTTCATAAAACTACAGATTTA
TAAATCTGTAGTTTTATGAAACTAGTTCTAAAATCTGTAGTTTAGTTTTATGAAATTTACTCATTTATTTAATTCTACAAATCAAAATGCAAACATATCC[A/G]
ATCATCACCCCCTCATGTCATTTGCACTATATTTTAACAAATCTATTTATCACTTTTACAATATTTAACATATACTTATCAATATGTTTCACACTAAAGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.80% | 1.60% | 0.74% | 61.83% | NA |
| All Indica | 2759 | 12.60% | 2.50% | 1.23% | 83.69% | NA |
| All Japonica | 1512 | 83.50% | 0.10% | 0.00% | 16.40% | NA |
| Aus | 269 | 12.30% | 1.90% | 0.37% | 85.50% | NA |
| Indica I | 595 | 28.60% | 5.20% | 1.51% | 64.71% | NA |
| Indica II | 465 | 2.40% | 1.10% | 1.08% | 95.48% | NA |
| Indica III | 913 | 9.10% | 2.70% | 0.77% | 87.40% | NA |
| Indica Intermediate | 786 | 10.70% | 0.90% | 1.65% | 86.77% | NA |
| Temperate Japonica | 767 | 91.10% | 0.00% | 0.00% | 8.87% | NA |
| Tropical Japonica | 504 | 76.20% | 0.00% | 0.00% | 23.81% | NA |
| Japonica Intermediate | 241 | 74.70% | 0.40% | 0.00% | 24.90% | NA |
| VI/Aromatic | 96 | 14.60% | 2.10% | 0.00% | 83.33% | NA |
| Intermediate | 90 | 38.90% | 0.00% | 0.00% | 61.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1002287752 | T -> C | LOC_Os10g04770.1 | downstream_gene_variant ; 1430.0bp to feature; MODIFIER | silent_mutation | Average:14.939; most accessible tissue: Callus, score: 25.642 | N | N | N | N |
| vg1002287752 | T -> C | LOC_Os10g04760-LOC_Os10g04770 | intergenic_region ; MODIFIER | silent_mutation | Average:14.939; most accessible tissue: Callus, score: 25.642 | N | N | N | N |
| vg1002287752 | T -> DEL | N | N | silent_mutation | Average:14.939; most accessible tissue: Callus, score: 25.642 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1002287752 | 1.20E-08 | NA | mr1486 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002287752 | 7.30E-06 | NA | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002287752 | 9.73E-07 | NA | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002287752 | 9.66E-06 | 9.32E-20 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002287752 | 1.03E-06 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002287752 | NA | 3.16E-09 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |