\
| Variant ID: vg1002269285 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 2269285 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.53, C: 0.47, others allele: 0.00, population size: 57. )
TGTGAAACTGAAAGCAAATTGTACTTTAAATCCTCAACCAAAGCTACATTCTTCAATTCAAATTTTTCATTTACCTTAACCGAACCTGTAGCGAGAATGG[A/C]
ACTTGTAGAAGCATCACGAAAGATAATCGATTCAGTCTTGGATGCCTTTTTGAGGGAGGAGAACCAATTTTTATCACCGGTCATGTGCCGCGAACAACCG
CGGTTGTTCGCGGCACATGACCGGTGATAAAAATTGGTTCTCCTCCCTCAAAAAGGCATCCAAGACTGAATCGATTATCTTTCGTGATGCTTCTACAAGT[T/G]
CCATTCTCGCTACAGGTTCGGTTAAGGTAAATGAAAAATTTGAATTGAAGAATGTAGCTTTGGTTGAGGATTTAAAGTACAATTTGCTTTCAGTTTCACA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 24.60% | 15.30% | 2.90% | 57.19% | NA |
| All Indica | 2759 | 4.70% | 12.00% | 3.23% | 80.07% | NA |
| All Japonica | 1512 | 60.00% | 24.70% | 0.46% | 14.81% | NA |
| Aus | 269 | 13.00% | 1.10% | 2.97% | 82.90% | NA |
| Indica I | 595 | 3.70% | 26.40% | 5.71% | 64.20% | NA |
| Indica II | 465 | 2.20% | 2.20% | 2.58% | 93.12% | NA |
| Indica III | 913 | 4.50% | 11.80% | 3.18% | 80.50% | NA |
| Indica Intermediate | 786 | 7.40% | 7.00% | 1.78% | 83.84% | NA |
| Temperate Japonica | 767 | 51.20% | 40.00% | 0.13% | 8.60% | NA |
| Tropical Japonica | 504 | 75.80% | 3.20% | 0.40% | 20.63% | NA |
| Japonica Intermediate | 241 | 54.80% | 21.20% | 1.66% | 22.41% | NA |
| VI/Aromatic | 96 | 64.60% | 1.00% | 28.12% | 6.25% | NA |
| Intermediate | 90 | 30.00% | 17.80% | 6.67% | 45.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1002269285 | A -> C | LOC_Os10g04740.1 | intron_variant ; MODIFIER | silent_mutation | Average:9.346; most accessible tissue: Callus, score: 19.884 | N | N | N | N |
| vg1002269285 | A -> DEL | N | N | silent_mutation | Average:9.346; most accessible tissue: Callus, score: 19.884 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1002269285 | NA | 8.75E-06 | mr1272 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002269285 | 2.16E-06 | NA | mr1486 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002269285 | 9.60E-06 | NA | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002269285 | 8.38E-06 | NA | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002269285 | 4.67E-06 | 8.63E-06 | mr1588 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002269285 | NA | 4.09E-08 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002269285 | 1.30E-06 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002269285 | 4.66E-06 | NA | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002269285 | 8.84E-06 | NA | mr1588_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002269285 | NA | 1.51E-16 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002269285 | NA | 2.65E-11 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002269285 | NA | 1.07E-09 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |