\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002266462:

Variant ID: vg1002266462 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2266462
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAAAGCGCGCACACAAACATACAACAAATTGTATGTCTGGCCTAGAAGCAGTTAGATACAACAAAGTTCCAATCATACTTCTATACTCCTTTTGATCAA[C/G]
AGCTTCACCATCTTCATCAGGATCCAACACAGCTGTAGAACCAATTGGTGTTGAAATTGGCTTGCATTTCTCCATCTTGAACCGTCTCAAGAGATCCTTC

Reverse complement sequence

GAAGGATCTCTTGAGACGGTTCAAGATGGAGAAATGCAAGCCAATTTCAACACCAATTGGTTCTACAGCTGTGTTGGATCCTGATGAAGATGGTGAAGCT[G/C]
TTGATCAAAAGGAGTATAGAAGTATGATTGGAACTTTGTTGTATCTAACTGCTTCTAGGCCAGACATACAATTTGTTGTATGTTTGTGTGCGCGCTTTCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.30% 1.50% 1.59% 54.63% NA
All Indica  2759 20.60% 0.10% 0.83% 78.47% NA
All Japonica  1512 81.80% 4.30% 2.45% 11.44% NA
Aus  269 22.30% 0.00% 3.35% 74.35% NA
Indica I  595 37.80% 0.20% 0.67% 61.34% NA
Indica II  465 6.20% 0.00% 0.43% 93.33% NA
Indica III  913 21.00% 0.00% 0.66% 78.31% NA
Indica Intermediate  786 15.50% 0.30% 1.40% 82.82% NA
Temperate Japonica  767 90.50% 0.10% 1.17% 8.21% NA
Tropical Japonica  504 70.60% 12.30% 4.76% 12.30% NA
Japonica Intermediate  241 77.60% 0.80% 1.66% 19.92% NA
VI/Aromatic  96 93.80% 0.00% 2.08% 4.17% NA
Intermediate  90 50.00% 1.10% 4.44% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002266462 C -> G LOC_Os10g04740.1 missense_variant ; p.Val801Leu; MODERATE nonsynonymous_codon ; V801L Average:6.31; most accessible tissue: Callus, score: 22.725 benign 1.33 DELETERIOUS 0.00
vg1002266462 C -> DEL LOC_Os10g04740.1 N frameshift_variant Average:6.31; most accessible tissue: Callus, score: 22.725 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002266462 NA 1.16E-07 mr1076 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002266462 NA 5.14E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002266462 NA 6.01E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002266462 NA 4.98E-09 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002266462 NA 7.77E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002266462 NA 4.10E-06 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002266462 NA 2.84E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002266462 NA 5.91E-08 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002266462 NA 6.76E-07 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002266462 NA 2.91E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251