Search for Variation information by Variation ID:
Detailed information for vg1002266462:
| Variant ID: vg1002266462 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 2266462 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
TGAAAGCGCGCACACAAACATACAACAAATTGTATGTCTGGCCTAGAAGCAGTTAGATACAACAAAGTTCCAATCATACTTCTATACTCCTTTTGATCAA[C/G]
AGCTTCACCATCTTCATCAGGATCCAACACAGCTGTAGAACCAATTGGTGTTGAAATTGGCTTGCATTTCTCCATCTTGAACCGTCTCAAGAGATCCTTC
Reverse complement sequence
GAAGGATCTCTTGAGACGGTTCAAGATGGAGAAATGCAAGCCAATTTCAACACCAATTGGTTCTACAGCTGTGTTGGATCCTGATGAAGATGGTGAAGCT[G/C]
TTGATCAAAAGGAGTATAGAAGTATGATTGGAACTTTGTTGTATCTAACTGCTTCTAGGCCAGACATACAATTTGTTGTATGTTTGTGTGCGCGCTTTCA
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.30% | 1.50% | 1.59% | 54.63% | NA |
| All Indica | 2759 | 20.60% | 0.10% | 0.83% | 78.47% | NA |
| All Japonica | 1512 | 81.80% | 4.30% | 2.45% | 11.44% | NA |
| Aus | 269 | 22.30% | 0.00% | 3.35% | 74.35% | NA |
| Indica I | 595 | 37.80% | 0.20% | 0.67% | 61.34% | NA |
| Indica II | 465 | 6.20% | 0.00% | 0.43% | 93.33% | NA |
| Indica III | 913 | 21.00% | 0.00% | 0.66% | 78.31% | NA |
| Indica Intermediate | 786 | 15.50% | 0.30% | 1.40% | 82.82% | NA |
| Temperate Japonica | 767 | 90.50% | 0.10% | 1.17% | 8.21% | NA |
| Tropical Japonica | 504 | 70.60% | 12.30% | 4.76% | 12.30% | NA |
| Japonica Intermediate | 241 | 77.60% | 0.80% | 1.66% | 19.92% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 2.08% | 4.17% | NA |
| Intermediate | 90 | 50.00% | 1.10% | 4.44% | 44.44% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1002266462 | C -> G | LOC_Os10g04740.1 | missense_variant ; p.Val801Leu; MODERATE | nonsynonymous_codon ; V801L | Average:6.31; most accessible tissue: Callus, score: 22.725 | benign  |
1.33 |
DELETERIOUS | 0.00 |
| vg1002266462 | C -> DEL | LOC_Os10g04740.1 | N | frameshift_variant | Average:6.31; most accessible tissue: Callus, score: 22.725 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1002266462 | NA | 1.16E-07 | mr1076 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002266462 | NA | 5.14E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002266462 | NA | 6.01E-07 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002266462 | NA | 4.98E-09 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002266462 | NA | 7.77E-06 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002266462 | NA | 4.10E-06 | mr1411 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002266462 | NA | 2.84E-06 | mr1560 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002266462 | NA | 5.91E-08 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002266462 | NA | 6.76E-07 | mr1121_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002266462 | NA | 2.91E-06 | mr1220_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |