\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002265707:

Variant ID: vg1002265707 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2265707
Reference Allele: AAlternative Allele: C,T
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCGCCCTTAAAAGCAAAATCTAAATCTCATGAAAAGACTATAATACATACAAGCTATGCTAGAGACAAATAAACCTTCAAAGTATTGCTAACATGCACA[A/C,T]
GAAAATACCATATGTATAAACAAAGCTCTCTTTTCTCAATTTTTCTCATTGTCATATTTTTGCTTGATAAAACCATAAGGTACAAACTCCCCCTCAAACC

Reverse complement sequence

GGTTTGAGGGGGAGTTTGTACCTTATGGTTTTATCAAGCAAAAATATGACAATGAGAAAAATTGAGAAAAGAGAGCTTTGTTTATACATATGGTATTTTC[T/G,A]
TGTGCATGTTAGCAATACTTTGAAGGTTTATTTGTCTCTAGCATAGCTTGTATGTATTATAGTCTTTTCATGAGATTTAGATTTTGCTTTTAAGGGCGAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.90% 8.00% 19.34% 20.08% T: 0.66%
All Indica  2759 27.10% 13.00% 29.47% 29.25% T: 1.12%
All Japonica  1512 90.50% 0.30% 2.31% 6.81% NA
Aus  269 71.40% 2.60% 16.73% 9.29% NA
Indica I  595 40.70% 9.40% 23.87% 26.05% NA
Indica II  465 11.80% 14.60% 32.90% 40.00% T: 0.65%
Indica III  913 29.00% 12.80% 30.78% 24.86% T: 2.52%
Indica Intermediate  786 23.70% 15.10% 30.15% 30.41% T: 0.64%
Temperate Japonica  767 92.80% 0.30% 1.30% 5.61% NA
Tropical Japonica  504 91.30% 0.00% 3.17% 5.56% NA
Japonica Intermediate  241 81.70% 1.20% 3.73% 13.28% NA
VI/Aromatic  96 94.80% 0.00% 5.21% 0.00% NA
Intermediate  90 61.10% 5.60% 17.78% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002265707 A -> C LOC_Os10g04730.1 downstream_gene_variant ; 3081.0bp to feature; MODIFIER silent_mutation Average:7.872; most accessible tissue: Callus, score: 13.703 N N N N
vg1002265707 A -> C LOC_Os10g04740.1 downstream_gene_variant ; 264.0bp to feature; MODIFIER silent_mutation Average:7.872; most accessible tissue: Callus, score: 13.703 N N N N
vg1002265707 A -> C LOC_Os10g04730-LOC_Os10g04740 intergenic_region ; MODIFIER silent_mutation Average:7.872; most accessible tissue: Callus, score: 13.703 N N N N
vg1002265707 A -> T LOC_Os10g04730.1 downstream_gene_variant ; 3081.0bp to feature; MODIFIER silent_mutation Average:7.872; most accessible tissue: Callus, score: 13.703 N N N N
vg1002265707 A -> T LOC_Os10g04740.1 downstream_gene_variant ; 264.0bp to feature; MODIFIER silent_mutation Average:7.872; most accessible tissue: Callus, score: 13.703 N N N N
vg1002265707 A -> T LOC_Os10g04730-LOC_Os10g04740 intergenic_region ; MODIFIER silent_mutation Average:7.872; most accessible tissue: Callus, score: 13.703 N N N N
vg1002265707 A -> DEL N N silent_mutation Average:7.872; most accessible tissue: Callus, score: 13.703 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002265707 9.77E-06 2.09E-21 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002265707 6.98E-07 1.89E-11 mr1632 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002265707 1.33E-07 7.23E-23 mr1039_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002265707 2.27E-07 3.49E-16 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251