| Variant ID: vg1002265707 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 2265707 |
| Reference Allele: A | Alternative Allele: C,T |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATCGCCCTTAAAAGCAAAATCTAAATCTCATGAAAAGACTATAATACATACAAGCTATGCTAGAGACAAATAAACCTTCAAAGTATTGCTAACATGCACA[A/C,T]
GAAAATACCATATGTATAAACAAAGCTCTCTTTTCTCAATTTTTCTCATTGTCATATTTTTGCTTGATAAAACCATAAGGTACAAACTCCCCCTCAAACC
GGTTTGAGGGGGAGTTTGTACCTTATGGTTTTATCAAGCAAAAATATGACAATGAGAAAAATTGAGAAAAGAGAGCTTTGTTTATACATATGGTATTTTC[T/G,A]
TGTGCATGTTAGCAATACTTTGAAGGTTTATTTGTCTCTAGCATAGCTTGTATGTATTATAGTCTTTTCATGAGATTTAGATTTTGCTTTTAAGGGCGAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.90% | 8.00% | 19.34% | 20.08% | T: 0.66% |
| All Indica | 2759 | 27.10% | 13.00% | 29.47% | 29.25% | T: 1.12% |
| All Japonica | 1512 | 90.50% | 0.30% | 2.31% | 6.81% | NA |
| Aus | 269 | 71.40% | 2.60% | 16.73% | 9.29% | NA |
| Indica I | 595 | 40.70% | 9.40% | 23.87% | 26.05% | NA |
| Indica II | 465 | 11.80% | 14.60% | 32.90% | 40.00% | T: 0.65% |
| Indica III | 913 | 29.00% | 12.80% | 30.78% | 24.86% | T: 2.52% |
| Indica Intermediate | 786 | 23.70% | 15.10% | 30.15% | 30.41% | T: 0.64% |
| Temperate Japonica | 767 | 92.80% | 0.30% | 1.30% | 5.61% | NA |
| Tropical Japonica | 504 | 91.30% | 0.00% | 3.17% | 5.56% | NA |
| Japonica Intermediate | 241 | 81.70% | 1.20% | 3.73% | 13.28% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 5.21% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 5.60% | 17.78% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1002265707 | A -> C | LOC_Os10g04730.1 | downstream_gene_variant ; 3081.0bp to feature; MODIFIER | silent_mutation | Average:7.872; most accessible tissue: Callus, score: 13.703 | N | N | N | N |
| vg1002265707 | A -> C | LOC_Os10g04740.1 | downstream_gene_variant ; 264.0bp to feature; MODIFIER | silent_mutation | Average:7.872; most accessible tissue: Callus, score: 13.703 | N | N | N | N |
| vg1002265707 | A -> C | LOC_Os10g04730-LOC_Os10g04740 | intergenic_region ; MODIFIER | silent_mutation | Average:7.872; most accessible tissue: Callus, score: 13.703 | N | N | N | N |
| vg1002265707 | A -> T | LOC_Os10g04730.1 | downstream_gene_variant ; 3081.0bp to feature; MODIFIER | silent_mutation | Average:7.872; most accessible tissue: Callus, score: 13.703 | N | N | N | N |
| vg1002265707 | A -> T | LOC_Os10g04740.1 | downstream_gene_variant ; 264.0bp to feature; MODIFIER | silent_mutation | Average:7.872; most accessible tissue: Callus, score: 13.703 | N | N | N | N |
| vg1002265707 | A -> T | LOC_Os10g04730-LOC_Os10g04740 | intergenic_region ; MODIFIER | silent_mutation | Average:7.872; most accessible tissue: Callus, score: 13.703 | N | N | N | N |
| vg1002265707 | A -> DEL | N | N | silent_mutation | Average:7.872; most accessible tissue: Callus, score: 13.703 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1002265707 | 9.77E-06 | 2.09E-21 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002265707 | 6.98E-07 | 1.89E-11 | mr1632 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002265707 | 1.33E-07 | 7.23E-23 | mr1039_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002265707 | 2.27E-07 | 3.49E-16 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |