| Variant ID: vg1002253792 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 2253792 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGCCGTCTGCCTCGCCACGCCCACGGCCTGGCCTGGCGCACGCACGCGTGTGGCTGTTCGCCCACCATCTCAACCGGTCAACAAAGACTCTCCACTAGCT[C/T]
TATCGAAGATTACAATTTTTTATAGAACATATCTCCATGTGAAGTCTTTTGCAAATATAAGAAAAACAAATTCAAAAATAGATCTGAGATTGGAAAAAAT
ATTTTTTCCAATCTCAGATCTATTTTTGAATTTGTTTTTCTTATATTTGCAAAAGACTTCACATGGAGATATGTTCTATAAAAAATTGTAATCTTCGATA[G/A]
AGCTAGTGGAGAGTCTTTGTTGACCGGTTGAGATGGTGGGCGAACAGCCACACGCGTGCGTGCGCCAGGCCAGGCCGTGGGCGTGGCGAGGCAGACGGCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.40% | 36.30% | 4.85% | 20.46% | NA |
| All Indica | 2759 | 16.30% | 48.30% | 7.32% | 28.05% | NA |
| All Japonica | 1512 | 84.10% | 8.50% | 0.86% | 6.55% | NA |
| Aus | 269 | 13.40% | 50.90% | 4.46% | 31.23% | NA |
| Indica I | 595 | 32.90% | 46.90% | 4.54% | 15.63% | NA |
| Indica II | 465 | 2.80% | 48.00% | 11.83% | 37.42% | NA |
| Indica III | 913 | 17.30% | 49.30% | 5.26% | 28.15% | NA |
| Indica Intermediate | 786 | 10.70% | 48.30% | 9.16% | 31.81% | NA |
| Temperate Japonica | 767 | 91.10% | 4.00% | 0.52% | 4.30% | NA |
| Tropical Japonica | 504 | 77.80% | 12.30% | 1.19% | 8.73% | NA |
| Japonica Intermediate | 241 | 75.10% | 14.50% | 1.24% | 9.13% | NA |
| VI/Aromatic | 96 | 15.60% | 83.30% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 44.40% | 43.30% | 2.22% | 10.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1002253792 | C -> T | LOC_Os10g04720.1 | upstream_gene_variant ; 1561.0bp to feature; MODIFIER | silent_mutation | Average:50.224; most accessible tissue: Callus, score: 67.699 | N | N | N | N |
| vg1002253792 | C -> T | LOC_Os10g04730.1 | upstream_gene_variant ; 3698.0bp to feature; MODIFIER | silent_mutation | Average:50.224; most accessible tissue: Callus, score: 67.699 | N | N | N | N |
| vg1002253792 | C -> T | LOC_Os10g04720-LOC_Os10g04730 | intergenic_region ; MODIFIER | silent_mutation | Average:50.224; most accessible tissue: Callus, score: 67.699 | N | N | N | N |
| vg1002253792 | C -> DEL | N | N | silent_mutation | Average:50.224; most accessible tissue: Callus, score: 67.699 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1002253792 | NA | 4.18E-06 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002253792 | 2.96E-07 | NA | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002253792 | NA | 1.72E-06 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002253792 | 3.76E-07 | NA | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002253792 | NA | 1.73E-06 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002253792 | 1.22E-07 | NA | mr1486_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002253792 | 4.92E-06 | NA | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002253792 | NA | 5.22E-12 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |