\
| Variant ID: vg1002248885 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 2248885 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTTTAATATATGGTGCCGTTAACTTTTGAATATGTATTTTGACCATTCATTTGATTCAAAATTTTTATGCAAACATAGAAAAATATAAGTCACGCTTAA[C/A,T]
GAAACTTTAGTGATAAATCAAATAAAAAACAAATAATGATTATATGATTTTTTAATAAAATAAACAGTGAAGCGCGTATAAGAAAAAAATCAACAACGTG
CACGTTGTTGATTTTTTTCTTATACGCGCTTCACTGTTTATTTTATTAAAAAATCATATAATCATTATTTGTTTTTTATTTGATTTATCACTAAAGTTTC[G/T,A]
TTAAGCGTGACTTATATTTTTCTATGTTTGCATAAAAATTTTGAATCAAATGAATGGTCAAAATACATATTCAAAAGTTAACGGCACCATATATTAAAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.70% | 0.10% | 1.38% | 59.73% | T: 0.02% |
| All Indica | 2759 | 16.90% | 0.10% | 0.69% | 82.28% | NA |
| All Japonica | 1512 | 84.10% | 0.00% | 0.26% | 15.54% | T: 0.07% |
| Aus | 269 | 13.80% | 0.00% | 4.46% | 81.78% | NA |
| Indica I | 595 | 33.80% | 0.00% | 0.34% | 65.88% | NA |
| Indica II | 465 | 3.70% | 0.00% | 0.43% | 95.91% | NA |
| Indica III | 913 | 17.70% | 0.10% | 0.55% | 81.60% | NA |
| Indica Intermediate | 786 | 11.10% | 0.30% | 1.27% | 87.40% | NA |
| Temperate Japonica | 767 | 90.90% | 0.00% | 0.26% | 8.87% | NA |
| Tropical Japonica | 504 | 78.00% | 0.00% | 0.20% | 21.63% | T: 0.20% |
| Japonica Intermediate | 241 | 75.50% | 0.00% | 0.41% | 24.07% | NA |
| VI/Aromatic | 96 | 15.60% | 4.20% | 29.17% | 51.04% | NA |
| Intermediate | 90 | 43.30% | 0.00% | 2.22% | 54.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1002248885 | C -> T | LOC_Os10g04700.1 | upstream_gene_variant ; 2912.0bp to feature; MODIFIER | silent_mutation | Average:28.339; most accessible tissue: Zhenshan97 root, score: 43.05 | N | N | N | N |
| vg1002248885 | C -> T | LOC_Os10g04700.2 | upstream_gene_variant ; 2912.0bp to feature; MODIFIER | silent_mutation | Average:28.339; most accessible tissue: Zhenshan97 root, score: 43.05 | N | N | N | N |
| vg1002248885 | C -> T | LOC_Os10g04710.1 | downstream_gene_variant ; 361.0bp to feature; MODIFIER | silent_mutation | Average:28.339; most accessible tissue: Zhenshan97 root, score: 43.05 | N | N | N | N |
| vg1002248885 | C -> T | LOC_Os10g04720.1 | downstream_gene_variant ; 495.0bp to feature; MODIFIER | silent_mutation | Average:28.339; most accessible tissue: Zhenshan97 root, score: 43.05 | N | N | N | N |
| vg1002248885 | C -> T | LOC_Os10g04710-LOC_Os10g04720 | intergenic_region ; MODIFIER | silent_mutation | Average:28.339; most accessible tissue: Zhenshan97 root, score: 43.05 | N | N | N | N |
| vg1002248885 | C -> A | LOC_Os10g04700.1 | upstream_gene_variant ; 2912.0bp to feature; MODIFIER | silent_mutation | Average:28.339; most accessible tissue: Zhenshan97 root, score: 43.05 | N | N | N | N |
| vg1002248885 | C -> A | LOC_Os10g04700.2 | upstream_gene_variant ; 2912.0bp to feature; MODIFIER | silent_mutation | Average:28.339; most accessible tissue: Zhenshan97 root, score: 43.05 | N | N | N | N |
| vg1002248885 | C -> A | LOC_Os10g04710.1 | downstream_gene_variant ; 361.0bp to feature; MODIFIER | silent_mutation | Average:28.339; most accessible tissue: Zhenshan97 root, score: 43.05 | N | N | N | N |
| vg1002248885 | C -> A | LOC_Os10g04720.1 | downstream_gene_variant ; 495.0bp to feature; MODIFIER | silent_mutation | Average:28.339; most accessible tissue: Zhenshan97 root, score: 43.05 | N | N | N | N |
| vg1002248885 | C -> A | LOC_Os10g04710-LOC_Os10g04720 | intergenic_region ; MODIFIER | silent_mutation | Average:28.339; most accessible tissue: Zhenshan97 root, score: 43.05 | N | N | N | N |
| vg1002248885 | C -> DEL | N | N | silent_mutation | Average:28.339; most accessible tissue: Zhenshan97 root, score: 43.05 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1002248885 | 6.19E-08 | NA | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002248885 | 3.79E-08 | 5.41E-24 | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002248885 | 8.71E-06 | NA | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002248885 | NA | 9.18E-20 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002248885 | NA | 3.21E-06 | mr1588 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002248885 | NA | 1.00E-06 | mr1709 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002248885 | 2.94E-07 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002248885 | 5.31E-06 | NA | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002248885 | 2.44E-06 | NA | mr1588_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002248885 | 5.39E-07 | 2.14E-06 | mr1588_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002248885 | NA | 1.38E-11 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |