\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002144991:

Variant ID: vg1002144991 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2144991
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTTAGACTTCTTTTATTCAATCCCATCCATGCCCTTAGGCCACAAAAGTGGATCAAAACAACATCTCAGCCTCTCAGGCCATGTAGGAAAGAGAGAAA[G/A]
AAAATCACTAGCATCACAAAAGCCTTTGGGGACGCAGATAGTTATCTCAACTTTAGGGTGCCATAATGAGATCTCAAAAGCCTTTGGTGTATATTCTAAA

Reverse complement sequence

TTTAGAATATACACCAAAGGCTTTTGAGATCTCATTATGGCACCCTAAAGTTGAGATAACTATCTGCGTCCCCAAAGGCTTTTGTGATGCTAGTGATTTT[C/T]
TTTCTCTCTTTCCTACATGGCCTGAGAGGCTGAGATGTTGTTTTGATCCACTTTTGTGGCCTAAGGGCATGGATGGGATTGAATAAAAGAAGTCTAAAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.60% 10.30% 0.02% 0.00% NA
All Indica  2759 96.90% 3.00% 0.04% 0.00% NA
All Japonica  1512 87.10% 12.90% 0.00% 0.00% NA
Aus  269 26.80% 73.20% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 96.60% 3.40% 0.00% 0.00% NA
Indica Intermediate  786 93.10% 6.70% 0.13% 0.00% NA
Temperate Japonica  767 92.20% 7.80% 0.00% 0.00% NA
Tropical Japonica  504 82.90% 17.10% 0.00% 0.00% NA
Japonica Intermediate  241 79.70% 20.30% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002144991 G -> A LOC_Os10g04520.1 upstream_gene_variant ; 1975.0bp to feature; MODIFIER silent_mutation Average:54.052; most accessible tissue: Zhenshan97 young leaf, score: 75.039 N N N N
vg1002144991 G -> A LOC_Os10g04510.1 downstream_gene_variant ; 569.0bp to feature; MODIFIER silent_mutation Average:54.052; most accessible tissue: Zhenshan97 young leaf, score: 75.039 N N N N
vg1002144991 G -> A LOC_Os10g04530.1 downstream_gene_variant ; 3691.0bp to feature; MODIFIER silent_mutation Average:54.052; most accessible tissue: Zhenshan97 young leaf, score: 75.039 N N N N
vg1002144991 G -> A LOC_Os10g04510-LOC_Os10g04520 intergenic_region ; MODIFIER silent_mutation Average:54.052; most accessible tissue: Zhenshan97 young leaf, score: 75.039 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002144991 NA 2.06E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002144991 4.65E-06 NA mr1825 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251