Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002137501:

Variant ID: vg1002137501 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2137501
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:

CCTGTCACCGTTGTCCCATCGCCATCGTCGCCATCAGCAACACAGGGAAGAGTATGGTTGGGGCGCTACCACCTCGCTGCCACACCTAGCCGGTGCCACG[A/G]
CTGTTGCCTACCCTGTCCTCCAAAGTCGCTATCGTCGCTGAGAGCCACCCGGGGACGTTGGATCCGGGCGGGCGGCCACCACCTCACAGGTCAGCACGAA

Reverse complement sequence

TTCGTGCTGACCTGTGAGGTGGTGGCCGCCCGCCCGGATCCAACGTCCCCGGGTGGCTCTCAGCGACGATAGCGACTTTGGAGGACAGGGTAGGCAACAG[T/C]
CGTGGCACCGGCTAGGTGTGGCAGCGAGGTGGTAGCGCCCCAACCATACTCTTCCCTGTGTTGCTGATGGCGACGATGGCGATGGGACAACGGTGACAGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.20%	34.50%	0.30%	0.00%	NA
All Indica	2759	43.20%	56.40%	0.47%	0.00%	NA
All Japonica	1512	98.70%	1.30%	0.00%	0.00%	NA
Aus	269	88.80%	11.20%	0.00%	0.00%	NA
Indica I	595	45.50%	54.10%	0.34%	0.00%	NA
Indica II	465	35.30%	64.30%	0.43%	0.00%	NA
Indica III	913	43.60%	55.90%	0.55%	0.00%	NA
Indica Intermediate	786	45.50%	53.90%	0.51%	0.00%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	97.60%	2.40%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	76.70%	22.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002137501	A -> G	LOC_Os10g04500.1	upstream_gene_variant ; 3997.0bp to feature; MODIFIER	silent_mutation	Average:64.517; most accessible tissue: Minghui63 young leaf, score: 78.821	N	N	N	N
vg1002137501	A -> G	LOC_Os10g04500-LOC_Os10g04510	intergenic_region ; MODIFIER	silent_mutation	Average:64.517; most accessible tissue: Minghui63 young leaf, score: 78.821	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002137501	NA	7.14E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002137501	NA	1.03E-07	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002137501	NA	9.78E-07	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002137501	3.43E-08	NA	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002137501	2.16E-08	4.35E-11	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002137501	3.11E-06	NA	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002137501	NA	3.28E-07	mr1548	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002137501	NA	5.27E-07	mr1588	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002137501	1.15E-06	1.15E-06	mr1597	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002137501	NA	1.82E-06	mr1624	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002137501	3.40E-06	NA	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002137501	1.32E-06	8.97E-10	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251