\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002137501:

Variant ID: vg1002137501 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2137501
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


CCTGTCACCGTTGTCCCATCGCCATCGTCGCCATCAGCAACACAGGGAAGAGTATGGTTGGGGCGCTACCACCTCGCTGCCACACCTAGCCGGTGCCACG[A/G]
CTGTTGCCTACCCTGTCCTCCAAAGTCGCTATCGTCGCTGAGAGCCACCCGGGGACGTTGGATCCGGGCGGGCGGCCACCACCTCACAGGTCAGCACGAA

Reverse complement sequence

TTCGTGCTGACCTGTGAGGTGGTGGCCGCCCGCCCGGATCCAACGTCCCCGGGTGGCTCTCAGCGACGATAGCGACTTTGGAGGACAGGGTAGGCAACAG[T/C]
CGTGGCACCGGCTAGGTGTGGCAGCGAGGTGGTAGCGCCCCAACCATACTCTTCCCTGTGTTGCTGATGGCGACGATGGCGATGGGACAACGGTGACAGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.20% 34.50% 0.30% 0.00% NA
All Indica  2759 43.20% 56.40% 0.47% 0.00% NA
All Japonica  1512 98.70% 1.30% 0.00% 0.00% NA
Aus  269 88.80% 11.20% 0.00% 0.00% NA
Indica I  595 45.50% 54.10% 0.34% 0.00% NA
Indica II  465 35.30% 64.30% 0.43% 0.00% NA
Indica III  913 43.60% 55.90% 0.55% 0.00% NA
Indica Intermediate  786 45.50% 53.90% 0.51% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 97.60% 2.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 76.70% 22.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002137501 A -> G LOC_Os10g04500.1 upstream_gene_variant ; 3997.0bp to feature; MODIFIER silent_mutation Average:64.517; most accessible tissue: Minghui63 young leaf, score: 78.821 N N N N
vg1002137501 A -> G LOC_Os10g04500-LOC_Os10g04510 intergenic_region ; MODIFIER silent_mutation Average:64.517; most accessible tissue: Minghui63 young leaf, score: 78.821 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002137501 NA 7.14E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002137501 NA 1.03E-07 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002137501 NA 9.78E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002137501 3.43E-08 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002137501 2.16E-08 4.35E-11 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002137501 3.11E-06 NA mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002137501 NA 3.28E-07 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002137501 NA 5.27E-07 mr1588 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002137501 1.15E-06 1.15E-06 mr1597 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002137501 NA 1.82E-06 mr1624 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002137501 3.40E-06 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002137501 1.32E-06 8.97E-10 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251