Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002108639:

Variant ID: vg1002108639 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2108639
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:

GTAAGATCTAATACGCTCGTCGTTGCAGACATGGCTGATCAAAGCTTTCTTTCCTACCCTGCAACCACCGATGATCGGAAGAACGAGAGGAGCACTATGA[T/C]
GACAAGGATTTTGCAACAAAATGTTGATAATCTGCTGCTTCTCGACATGACGAGCAAACATAAAATTATCTGTGTAGAGGTAAGTATCATAGGGCCTGCG

Reverse complement sequence

CGCAGGCCCTATGATACTTACCTCTACACAGATAATTTTATGTTTGCTCGTCATGTCGAGAAGCAGCAGATTATCAACATTTTGTTGCAAAATCCTTGTC[A/G]
TCATAGTGCTCCTCTCGTTCTTCCGATCATCGGTGGTTGCAGGGTAGGAAAGAAAGCTTTGATCAGCCATGTCTGCAACGACGAGCGTATTAGATCTTAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.80%	6.20%	0.04%	0.00%	NA
All Indica	2759	89.90%	10.10%	0.07%	0.00%	NA
All Japonica	1512	99.20%	0.80%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	73.90%	26.10%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	92.00%	7.80%	0.22%	0.00%	NA
Indica Intermediate	786	94.00%	6.00%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	97.80%	2.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002108639	T -> C	LOC_Os10g04470.1	missense_variant ; p.His173Arg; MODERATE	nonsynonymous_codon ; H173R	Average:40.352; most accessible tissue: Zhenshan97 young leaf, score: 64.747	possibly damaging	1.579	TOLERATED	0.53

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002108639	3.67E-09	NA	mr1486	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002108639	4.70E-09	3.67E-06	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002108639	2.13E-09	NA	mr1548	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002108639	3.16E-08	5.87E-06	mr1548	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002108639	3.87E-07	NA	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002108639	5.64E-07	1.17E-06	mr1588	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002108639	NA	5.84E-07	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002108639	1.40E-08	NA	mr1486_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002108639	6.22E-09	NA	mr1486_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002108639	1.11E-08	NA	mr1588_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002108639	6.58E-09	1.25E-06	mr1588_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002108639	2.16E-07	1.78E-13	mr1709_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002108639	6.94E-06	5.67E-10	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251