\
| Variant ID: vg1002107770 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 2107770 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )
CATATAGAACACTTATTTTGCTCTACAATTTTTGTGTATTATTTTTCCCTCAGTTAGAAAGCAATGCCGAACTTCCATCAACCAAATTAACTACTAGATC[G/A]
GCGCTTTCTCATAGTTTTGAATCCATTCTTGTCATCGACAAAAGATGTACCAGATGATACATACTTAGTATAAGGTGGTATTCGTGATTTCCATGTTACT
AGTAACATGGAAATCACGAATACCACCTTATACTAAGTATGTATCATCTGGTACATCTTTTGTCGATGACAAGAATGGATTCAAAACTATGAGAAAGCGC[C/T]
GATCTAGTAGTTAATTTGGTTGATGGAAGTTCGGCATTGCTTTCTAACTGAGGGAAAAATAATACACAAAAATTGTAGAGCAAAATAAGTGTTCTATATG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.50% | 8.10% | 0.36% | 0.00% | NA |
| All Indica | 2759 | 89.70% | 10.20% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 92.70% | 6.50% | 0.86% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 73.90% | 26.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 91.50% | 8.20% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 94.00% | 6.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.00% | 0.50% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 93.50% | 6.00% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 71.00% | 26.60% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 5.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1002107770 | G -> A | LOC_Os10g04470.1 | stop_gained ; p.Arg463*; HIGH | stop_gained | Average:30.939; most accessible tissue: Zhenshan97 young leaf, score: 58.398 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1002107770 | 1.90E-08 | NA | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002107770 | 2.59E-09 | 6.34E-06 | mr1486 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002107770 | 4.08E-09 | NA | mr1548 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002107770 | 3.88E-08 | 9.29E-06 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002107770 | 9.43E-08 | NA | mr1588 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002107770 | 3.11E-07 | 1.20E-06 | mr1588 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002107770 | NA | 5.62E-08 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002107770 | 3.56E-08 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002107770 | 9.66E-10 | NA | mr1486_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002107770 | 2.46E-08 | NA | mr1588_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002107770 | 1.63E-09 | 9.98E-07 | mr1588_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002107770 | 4.67E-07 | 8.77E-15 | mr1709_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002107770 | NA | 1.90E-10 | mr1709_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |