\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002102348:

Variant ID: vg1002102348 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2102348
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTTGAGATTCCAACTGTGATACCTATTGTTGATAGTTGCGGGCTTAGTTGGCCGGAGGACATCAATTTGGAGTGATTGTAATGATTTGATCCCACTGTT[A/C]
TGTTATTTGCTACCAAGATTTTTTTAATACTTGTTTCGAAGCAAATGCTAGCCCATCCGAAAAATGGGCAACCTAATGGTGGTTACATATTCTTTACTGA

Reverse complement sequence

TCAGTAAAGAATATGTAACCACCATTAGGTTGCCCATTTTTCGGATGGGCTAGCATTTGCTTCGAAACAAGTATTAAAAAAATCTTGGTAGCAAATAACA[T/G]
AACAGTGGGATCAAATCATTACAATCACTCCAAATTGATGTCCTCCGGCCAACTAAGCCCGCAACTATCAACAATAGGTATCACAGTTGGAATCTCAAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.10% 31.80% 0.06% 0.00% NA
All Indica  2759 92.50% 7.50% 0.07% 0.00% NA
All Japonica  1512 38.20% 61.70% 0.07% 0.00% NA
Aus  269 15.60% 84.40% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 88.10% 11.90% 0.00% 0.00% NA
Indica Intermediate  786 88.30% 11.70% 0.00% 0.00% NA
Temperate Japonica  767 66.50% 33.50% 0.00% 0.00% NA
Tropical Japonica  504 3.40% 96.60% 0.00% 0.00% NA
Japonica Intermediate  241 21.20% 78.40% 0.41% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 48.90% 51.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002102348 A -> C LOC_Os10g04450.1 upstream_gene_variant ; 2525.0bp to feature; MODIFIER silent_mutation Average:67.202; most accessible tissue: Minghui63 flag leaf, score: 80.516 N N N N
vg1002102348 A -> C LOC_Os10g04460.1 upstream_gene_variant ; 716.0bp to feature; MODIFIER silent_mutation Average:67.202; most accessible tissue: Minghui63 flag leaf, score: 80.516 N N N N
vg1002102348 A -> C LOC_Os10g04460-LOC_Os10g04470 intergenic_region ; MODIFIER silent_mutation Average:67.202; most accessible tissue: Minghui63 flag leaf, score: 80.516 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002102348 NA 2.92E-07 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002102348 NA 3.55E-09 mr1047 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002102348 NA 3.25E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002102348 NA 1.71E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002102348 NA 5.05E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002102348 NA 8.63E-24 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002102348 NA 3.02E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002102348 NA 9.97E-24 mr1825 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002102348 NA 5.89E-07 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002102348 NA 3.79E-32 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002102348 NA 2.61E-30 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251