\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002067295:

Variant ID: vg1002067295 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2067295
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATTTTCTCCATCGATGCATGGACTTACATTGCAAAATGACAACTGCACGCAGACGCTGTTAAGTAGATATCTTATGAACTCGAATATTTATACAACTTC[A/G]
AAACCTCCCAACTGCCAGTCAAGCTAATTTCTAACTGACGATACAAGCAGTCAAAAAGAAATGTTTAATATGTATTATAATTACCGCGTGATATTATTAA

Reverse complement sequence

TTAATAATATCACGCGGTAATTATAATACATATTAAACATTTCTTTTTGACTGCTTGTATCGTCAGTTAGAAATTAGCTTGACTGGCAGTTGGGAGGTTT[T/C]
GAAGTTGTATAAATATTCGAGTTCATAAGATATCTACTTAACAGCGTCTGCGTGCAGTTGTCATTTTGCAATGTAAGTCCATGCATCGATGGAGAAAATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.50% 0.60% 0.93% 0.00% NA
All Indica  2759 99.20% 0.00% 0.80% 0.00% NA
All Japonica  1512 96.80% 1.70% 1.46% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 98.40% 0.00% 1.64% 0.00% NA
Indica Intermediate  786 99.20% 0.00% 0.76% 0.00% NA
Temperate Japonica  767 93.70% 3.40% 2.87% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002067295 A -> G LOC_Os10g04380.1 upstream_gene_variant ; 3291.0bp to feature; MODIFIER silent_mutation Average:32.642; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg1002067295 A -> G LOC_Os10g04380-LOC_Os10g04400 intergenic_region ; MODIFIER silent_mutation Average:32.642; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002067295 NA 1.76E-06 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002067295 5.26E-06 5.26E-06 mr1166 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002067295 2.52E-09 1.09E-13 mr1210 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002067295 2.91E-08 1.22E-12 mr1305 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002067295 1.11E-06 1.11E-06 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002067295 NA 1.32E-07 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002067295 1.94E-08 2.63E-13 mr1585 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002067295 2.36E-08 6.07E-13 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002067295 1.60E-06 1.60E-06 mr1649 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002067295 NA 1.63E-07 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002067295 6.86E-06 1.53E-06 mr1897 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002067295 2.29E-07 9.46E-11 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002067295 NA 5.47E-06 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002067295 NA 2.25E-07 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002067295 3.48E-08 8.92E-14 mr1585_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002067295 NA 2.30E-06 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251