\
| Variant ID: vg1002061060 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 2061060 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTGACTTTGAGATTAGTGCTATTAAGTAAGACGAAAATAAAAGGGTGAATAGTCAGTTAACTCCTTTAACTTTTGCTCAGAGGTCGAATTAGTCCTGGAT[A/G]
CTTTATAATATCCAAACAAGACCCTACAAATATCATGCGGCTTAATATAGTCCTTAAACTCACTTAAAACGCCATATGGACATGCCACATCATTTGTGCT
AGCACAAATGATGTGGCATGTCCATATGGCGTTTTAAGTGAGTTTAAGGACTATATTAAGCCGCATGATATTTGTAGGGTCTTGTTTGGATATTATAAAG[T/C]
ATCCAGGACTAATTCGACCTCTGAGCAAAAGTTAAAGGAGTTAACTGACTATTCACCCTTTTATTTTCGTCTTACTTAATAGCACTAATCTCAAAGTCAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.00% | 7.90% | 1.14% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.50% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 74.20% | 22.70% | 3.11% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.20% | 0.67% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.40% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.60% | 0.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 66.00% | 29.10% | 4.95% | 0.00% | NA |
| Tropical Japonica | 504 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 57.30% | 39.00% | 3.73% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 12.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1002061060 | A -> G | LOC_Os10g04370.1 | upstream_gene_variant ; 243.0bp to feature; MODIFIER | silent_mutation | Average:46.393; most accessible tissue: Callus, score: 85.002 | N | N | N | N |
| vg1002061060 | A -> G | LOC_Os10g04370.2 | upstream_gene_variant ; 243.0bp to feature; MODIFIER | silent_mutation | Average:46.393; most accessible tissue: Callus, score: 85.002 | N | N | N | N |
| vg1002061060 | A -> G | LOC_Os10g04342.1 | downstream_gene_variant ; 3501.0bp to feature; MODIFIER | silent_mutation | Average:46.393; most accessible tissue: Callus, score: 85.002 | N | N | N | N |
| vg1002061060 | A -> G | LOC_Os10g04380.1 | downstream_gene_variant ; 1433.0bp to feature; MODIFIER | silent_mutation | Average:46.393; most accessible tissue: Callus, score: 85.002 | N | N | N | N |
| vg1002061060 | A -> G | LOC_Os10g04370-LOC_Os10g04380 | intergenic_region ; MODIFIER | silent_mutation | Average:46.393; most accessible tissue: Callus, score: 85.002 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1002061060 | 8.74E-07 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002061060 | 2.60E-06 | 3.87E-10 | mr1959 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002061060 | 3.26E-07 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002061060 | 3.94E-07 | NA | mr1959_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |