\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002045263:

Variant ID: vg1002045263 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2045263
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCCTTTGTTTCTTCTGTTGTGAGATACCTCACGAACCCCTTCCAGTGTCTAATCGATCGGGCGATTGATTTAGGGTTTAGGGTTGGAGAGAGTTGAGT[G/C]
GTCACCTGCCTCCCTCCTTTCTCTTTCTTTTATATAGCGACACTGGTGGGGCTCGGAGGTTTATCTCAATCTAAAATTCGAATCTATTTTGTACCGATCA

Reverse complement sequence

TGATCGGTACAAAATAGATTCGAATTTTAGATTGAGATAAACCTCCGAGCCCCACCAGTGTCGCTATATAAAAGAAAGAGAAAGGAGGGAGGCAGGTGAC[C/G]
ACTCAACTCTCTCCAACCCTAAACCCTAAATCAATCGCCCGATCGATTAGACACTGGAAGGGGTTCGTGAGGTATCTCACAACAGAAGAAACAAAGGAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.40% 36.30% 1.18% 14.11% NA
All Indica  2759 73.50% 4.20% 1.12% 21.17% NA
All Japonica  1512 3.70% 96.20% 0.00% 0.07% NA
Aus  269 58.40% 4.10% 8.55% 29.00% NA
Indica I  595 56.00% 3.50% 1.34% 39.16% NA
Indica II  465 80.20% 3.90% 0.65% 15.27% NA
Indica III  913 79.30% 2.70% 1.42% 16.54% NA
Indica Intermediate  786 76.20% 6.50% 0.89% 16.41% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 7.10% 92.90% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.30% 0.00% 0.41% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 42.20% 51.10% 2.22% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002045263 G -> C LOC_Os10g04316.1 downstream_gene_variant ; 3743.0bp to feature; MODIFIER silent_mutation Average:51.424; most accessible tissue: Minghui63 young leaf, score: 80.234 N N N N
vg1002045263 G -> C LOC_Os10g04342.1 intron_variant ; MODIFIER silent_mutation Average:51.424; most accessible tissue: Minghui63 young leaf, score: 80.234 N N N N
vg1002045263 G -> DEL N N silent_mutation Average:51.424; most accessible tissue: Minghui63 young leaf, score: 80.234 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1002045263 G C -0.07 -0.05 -0.05 -0.06 -0.08 -0.08

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002045263 NA 1.55E-10 mr1302 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002045263 NA 1.07E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002045263 NA 2.58E-16 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002045263 NA 1.17E-08 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002045263 NA 4.79E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002045263 NA 1.71E-06 mr1374 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002045263 NA 4.09E-09 mr1392 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002045263 NA 2.93E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002045263 NA 6.41E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002045263 NA 1.33E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002045263 NA 5.53E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002045263 NA 3.67E-08 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002045263 NA 1.39E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002045263 NA 7.52E-14 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002045263 NA 1.86E-10 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002045263 NA 3.75E-08 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002045263 NA 1.34E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002045263 NA 5.69E-08 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002045263 NA 1.59E-12 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251