\
| Variant ID: vg1002034525 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 2034525 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TATGCAGTATTGGAGTATCTTTGCCCCTGCTGCTGCTGCCCAATGTGTTCCTTGTTAAATGGCCAGTGATGAATTGCTCAATAAGAATAGATTATCTATA[C/A]
ACTTGTTCATTTTTTTATCTATTCTTCTTTTTTCTGGATTGATAAGAGGAGACTATCTAGACATGTTGTTTTAGTTAATTTGCCCCTGTGGACTATCTTT
AAAGATAGTCCACAGGGGCAAATTAACTAAAACAACATGTCTAGATAGTCTCCTCTTATCAATCCAGAAAAAAGAAGAATAGATAAAAAAATGAACAAGT[G/T]
TATAGATAATCTATTCTTATTGAGCAATTCATCACTGGCCATTTAACAAGGAACACATTGGGCAGCAGCAGCAGGGGCAAAGATACTCCAATACTGCATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.90% | 0.70% | 2.69% | 8.80% | NA |
| All Indica | 2759 | 82.80% | 0.00% | 3.81% | 13.37% | NA |
| All Japonica | 1512 | 97.10% | 2.00% | 0.86% | 0.07% | NA |
| Aus | 269 | 80.70% | 0.00% | 2.97% | 16.36% | NA |
| Indica I | 595 | 63.50% | 0.00% | 6.22% | 30.25% | NA |
| Indica II | 465 | 86.20% | 0.00% | 5.38% | 8.39% | NA |
| Indica III | 913 | 91.50% | 0.00% | 1.10% | 7.45% | NA |
| Indica Intermediate | 786 | 85.40% | 0.00% | 4.20% | 10.43% | NA |
| Temperate Japonica | 767 | 94.40% | 3.90% | 1.69% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 1.10% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1002034525 | C -> A | LOC_Os10g04316.1 | upstream_gene_variant ; 609.0bp to feature; MODIFIER | silent_mutation | Average:16.742; most accessible tissue: Callus, score: 37.805 | N | N | N | N |
| vg1002034525 | C -> A | LOC_Os10g04290.1 | downstream_gene_variant ; 2140.0bp to feature; MODIFIER | silent_mutation | Average:16.742; most accessible tissue: Callus, score: 37.805 | N | N | N | N |
| vg1002034525 | C -> A | LOC_Os10g04290-LOC_Os10g04316 | intergenic_region ; MODIFIER | silent_mutation | Average:16.742; most accessible tissue: Callus, score: 37.805 | N | N | N | N |
| vg1002034525 | C -> DEL | N | N | silent_mutation | Average:16.742; most accessible tissue: Callus, score: 37.805 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1002034525 | 5.72E-09 | 1.64E-12 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002034525 | 2.75E-06 | 2.03E-09 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002034525 | 4.01E-07 | 5.95E-11 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002034525 | 1.30E-08 | 2.39E-12 | mr1586 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002034525 | NA | 1.66E-06 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002034525 | 2.96E-06 | 3.40E-09 | mr1305_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002034525 | 6.53E-06 | 2.18E-07 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002034525 | 3.86E-07 | 8.86E-12 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002034525 | NA | 7.48E-07 | mr1793_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |