Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002034525:

Variant ID: vg1002034525 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2034525
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATGCAGTATTGGAGTATCTTTGCCCCTGCTGCTGCTGCCCAATGTGTTCCTTGTTAAATGGCCAGTGATGAATTGCTCAATAAGAATAGATTATCTATA[C/A]
ACTTGTTCATTTTTTTATCTATTCTTCTTTTTTCTGGATTGATAAGAGGAGACTATCTAGACATGTTGTTTTAGTTAATTTGCCCCTGTGGACTATCTTT

Reverse complement sequence

AAAGATAGTCCACAGGGGCAAATTAACTAAAACAACATGTCTAGATAGTCTCCTCTTATCAATCCAGAAAAAAGAAGAATAGATAAAAAAATGAACAAGT[G/T]
TATAGATAATCTATTCTTATTGAGCAATTCATCACTGGCCATTTAACAAGGAACACATTGGGCAGCAGCAGCAGGGGCAAAGATACTCCAATACTGCATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.90%	0.70%	2.69%	8.80%	NA
All Indica	2759	82.80%	0.00%	3.81%	13.37%	NA
All Japonica	1512	97.10%	2.00%	0.86%	0.07%	NA
Aus	269	80.70%	0.00%	2.97%	16.36%	NA
Indica I	595	63.50%	0.00%	6.22%	30.25%	NA
Indica II	465	86.20%	0.00%	5.38%	8.39%	NA
Indica III	913	91.50%	0.00%	1.10%	7.45%	NA
Indica Intermediate	786	85.40%	0.00%	4.20%	10.43%	NA
Temperate Japonica	767	94.40%	3.90%	1.69%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	95.60%	1.10%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002034525	C -> A	LOC_Os10g04316.1	upstream_gene_variant ; 609.0bp to feature; MODIFIER	silent_mutation	Average:16.742; most accessible tissue: Callus, score: 37.805	N	N	N	N
vg1002034525	C -> A	LOC_Os10g04290.1	downstream_gene_variant ; 2140.0bp to feature; MODIFIER	silent_mutation	Average:16.742; most accessible tissue: Callus, score: 37.805	N	N	N	N
vg1002034525	C -> A	LOC_Os10g04290-LOC_Os10g04316	intergenic_region ; MODIFIER	silent_mutation	Average:16.742; most accessible tissue: Callus, score: 37.805	N	N	N	N
vg1002034525	C -> DEL	N	N	silent_mutation	Average:16.742; most accessible tissue: Callus, score: 37.805	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002034525	5.72E-09	1.64E-12	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002034525	2.75E-06	2.03E-09	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002034525	4.01E-07	5.95E-11	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002034525	1.30E-08	2.39E-12	mr1586	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002034525	NA	1.66E-06	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002034525	2.96E-06	3.40E-09	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002034525	6.53E-06	2.18E-07	mr1559_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002034525	3.86E-07	8.86E-12	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002034525	NA	7.48E-07	mr1793_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251