\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002034525:

Variant ID: vg1002034525 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2034525
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATGCAGTATTGGAGTATCTTTGCCCCTGCTGCTGCTGCCCAATGTGTTCCTTGTTAAATGGCCAGTGATGAATTGCTCAATAAGAATAGATTATCTATA[C/A]
ACTTGTTCATTTTTTTATCTATTCTTCTTTTTTCTGGATTGATAAGAGGAGACTATCTAGACATGTTGTTTTAGTTAATTTGCCCCTGTGGACTATCTTT

Reverse complement sequence

AAAGATAGTCCACAGGGGCAAATTAACTAAAACAACATGTCTAGATAGTCTCCTCTTATCAATCCAGAAAAAAGAAGAATAGATAAAAAAATGAACAAGT[G/T]
TATAGATAATCTATTCTTATTGAGCAATTCATCACTGGCCATTTAACAAGGAACACATTGGGCAGCAGCAGCAGGGGCAAAGATACTCCAATACTGCATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.90% 0.70% 2.69% 8.80% NA
All Indica  2759 82.80% 0.00% 3.81% 13.37% NA
All Japonica  1512 97.10% 2.00% 0.86% 0.07% NA
Aus  269 80.70% 0.00% 2.97% 16.36% NA
Indica I  595 63.50% 0.00% 6.22% 30.25% NA
Indica II  465 86.20% 0.00% 5.38% 8.39% NA
Indica III  913 91.50% 0.00% 1.10% 7.45% NA
Indica Intermediate  786 85.40% 0.00% 4.20% 10.43% NA
Temperate Japonica  767 94.40% 3.90% 1.69% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 1.10% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002034525 C -> A LOC_Os10g04316.1 upstream_gene_variant ; 609.0bp to feature; MODIFIER silent_mutation Average:16.742; most accessible tissue: Callus, score: 37.805 N N N N
vg1002034525 C -> A LOC_Os10g04290.1 downstream_gene_variant ; 2140.0bp to feature; MODIFIER silent_mutation Average:16.742; most accessible tissue: Callus, score: 37.805 N N N N
vg1002034525 C -> A LOC_Os10g04290-LOC_Os10g04316 intergenic_region ; MODIFIER silent_mutation Average:16.742; most accessible tissue: Callus, score: 37.805 N N N N
vg1002034525 C -> DEL N N silent_mutation Average:16.742; most accessible tissue: Callus, score: 37.805 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002034525 5.72E-09 1.64E-12 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002034525 2.75E-06 2.03E-09 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002034525 4.01E-07 5.95E-11 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002034525 1.30E-08 2.39E-12 mr1586 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002034525 NA 1.66E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002034525 2.96E-06 3.40E-09 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002034525 6.53E-06 2.18E-07 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002034525 3.86E-07 8.86E-12 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002034525 NA 7.48E-07 mr1793_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251