\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002032071:

Variant ID: vg1002032071 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2032071
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGACGGTGGACGTCGTGTTCAATACTATGGTAGAGTTGAGCAAATATTGGAGCTAGATTACTTGAAGTTCAAAGTCCCGTTGTTTCATTGTCGATGGGTC[G/A]
ATCTTCGCAATGTAAAAGTTGACAATGAAGGTTTCACCACTGTCAACTTGGCTAACAACGCGTACAAGGATGAACCATTCGTTCTCGCCAAACAAGTTGT

Reverse complement sequence

ACAACTTGTTTGGCGAGAACGAATGGTTCATCCTTGTACGCGTTGTTAGCCAAGTTGACAGTGGTGAAACCTTCATTGTCAACTTTTACATTGCGAAGAT[C/T]
GACCCATCGACAATGAAACAACGGGACTTTGAACTTCAAGTAATCTAGCTCCAATATTTGCTCAACTCTACCATAGTATTGAACACGACGTCCACCGTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.40% 0.30% 0.76% 6.47% NA
All Indica  2759 89.90% 0.00% 0.69% 9.39% NA
All Japonica  1512 97.90% 1.00% 1.12% 0.00% NA
Aus  269 82.90% 0.00% 0.00% 17.10% NA
Indica I  595 85.40% 0.00% 1.01% 13.61% NA
Indica II  465 91.60% 0.00% 0.00% 8.39% NA
Indica III  913 89.70% 0.00% 0.99% 9.31% NA
Indica Intermediate  786 92.60% 0.00% 0.51% 6.87% NA
Temperate Japonica  767 95.80% 2.00% 2.22% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002032071 G -> A LOC_Os10g04290.1 missense_variant ; p.Asp2048Asn; MODERATE nonsynonymous_codon ; D2048N Average:14.128; most accessible tissue: Minghui63 root, score: 25.504 benign 0.407 TOLERATED 0.77
vg1002032071 G -> DEL LOC_Os10g04290.1 N frameshift_variant Average:14.128; most accessible tissue: Minghui63 root, score: 25.504 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002032071 5.59E-08 1.27E-11 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002032071 3.61E-07 1.06E-10 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002032071 4.39E-06 4.39E-06 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002032071 NA 6.18E-07 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002032071 3.04E-07 3.35E-11 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002032071 3.05E-07 4.74E-11 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002032071 1.73E-06 1.73E-06 mr1649 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002032071 NA 6.10E-07 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002032071 3.64E-07 3.30E-10 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002032071 NA 6.92E-06 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002032071 8.59E-06 2.52E-07 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002032071 4.35E-08 6.95E-13 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002032071 2.93E-06 1.61E-07 mr1793_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251