Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002032071:

Variant ID: vg1002032071 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2032071
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGACGGTGGACGTCGTGTTCAATACTATGGTAGAGTTGAGCAAATATTGGAGCTAGATTACTTGAAGTTCAAAGTCCCGTTGTTTCATTGTCGATGGGTC[G/A]
ATCTTCGCAATGTAAAAGTTGACAATGAAGGTTTCACCACTGTCAACTTGGCTAACAACGCGTACAAGGATGAACCATTCGTTCTCGCCAAACAAGTTGT

Reverse complement sequence

ACAACTTGTTTGGCGAGAACGAATGGTTCATCCTTGTACGCGTTGTTAGCCAAGTTGACAGTGGTGAAACCTTCATTGTCAACTTTTACATTGCGAAGAT[C/T]
GACCCATCGACAATGAAACAACGGGACTTTGAACTTCAAGTAATCTAGCTCCAATATTTGCTCAACTCTACCATAGTATTGAACACGACGTCCACCGTCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.40%	0.30%	0.76%	6.47%	NA
All Indica	2759	89.90%	0.00%	0.69%	9.39%	NA
All Japonica	1512	97.90%	1.00%	1.12%	0.00%	NA
Aus	269	82.90%	0.00%	0.00%	17.10%	NA
Indica I	595	85.40%	0.00%	1.01%	13.61%	NA
Indica II	465	91.60%	0.00%	0.00%	8.39%	NA
Indica III	913	89.70%	0.00%	0.99%	9.31%	NA
Indica Intermediate	786	92.60%	0.00%	0.51%	6.87%	NA
Temperate Japonica	767	95.80%	2.00%	2.22%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	1.10%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002032071	G -> A	LOC_Os10g04290.1	missense_variant ; p.Asp2048Asn; MODERATE	nonsynonymous_codon ; D2048N	Average:14.128; most accessible tissue: Minghui63 root, score: 25.504	benign	0.407	TOLERATED	0.77
vg1002032071	G -> DEL	LOC_Os10g04290.1	N	frameshift_variant	Average:14.128; most accessible tissue: Minghui63 root, score: 25.504	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002032071	5.59E-08	1.27E-11	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002032071	3.61E-07	1.06E-10	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002032071	4.39E-06	4.39E-06	mr1409	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002032071	NA	6.18E-07	mr1515	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002032071	3.04E-07	3.35E-11	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002032071	3.05E-07	4.74E-11	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002032071	1.73E-06	1.73E-06	mr1649	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002032071	NA	6.10E-07	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002032071	3.64E-07	3.30E-10	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002032071	NA	6.92E-06	mr1409_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002032071	8.59E-06	2.52E-07	mr1559_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002032071	4.35E-08	6.95E-13	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002032071	2.93E-06	1.61E-07	mr1793_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251