Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002009944:

Variant ID: vg1002009944 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2009944
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATACATGAGGTAGGCAGCCTAAAGCCACGAACCAAACTTATACTAGGAGTCCTAAACACCTTAGGAAACCCTCTAGTACAAGAAAGAAACTTTACATAAC[C/T]
AGTCGTACCAAATTTGGACTCCTTCCAAATTCGACTCCGCATCCCATACGCACACAATAACTCCATCGTATGCCATATGGAATCTCCATCAACCACGTGC

Reverse complement sequence

GCACGTGGTTGATGGAGATTCCATATGGCATACGATGGAGTTATTGTGTGCGTATGGGATGCGGAGTCGAATTTGGAAGGAGTCCAAATTTGGTACGACT[G/A]
GTTATGTAAAGTTTCTTTCTTGTACTAGAGGGTTTCCTAAGGTGTTTAGGACTCCTAGTATAAGTTTGGTTCGTGGCTTTAGGCTGCCTACCTCATGTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.80%	1.90%	1.38%	0.97%	NA
All Indica	2759	96.40%	0.20%	1.78%	1.63%	NA
All Japonica	1512	94.80%	4.90%	0.26%	0.00%	NA
Aus	269	94.80%	0.70%	4.09%	0.37%	NA
Indica I	595	96.10%	0.20%	2.86%	0.84%	NA
Indica II	465	98.10%	0.20%	0.65%	1.08%	NA
Indica III	913	95.70%	0.20%	1.86%	2.19%	NA
Indica Intermediate	786	96.40%	0.10%	1.53%	1.91%	NA
Temperate Japonica	767	98.20%	1.30%	0.52%	0.00%	NA
Tropical Japonica	504	96.00%	4.00%	0.00%	0.00%	NA
Japonica Intermediate	241	81.70%	18.30%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	95.60%	3.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002009944	C -> T	LOC_Os10g04280.1	upstream_gene_variant ; 1055.0bp to feature; MODIFIER	silent_mutation	Average:31.283; most accessible tissue: Minghui63 flag leaf, score: 56.489	N	N	N	N
vg1002009944	C -> T	LOC_Os10g04270-LOC_Os10g04280	intergenic_region ; MODIFIER	silent_mutation	Average:31.283; most accessible tissue: Minghui63 flag leaf, score: 56.489	N	N	N	N
vg1002009944	C -> DEL	N	N	silent_mutation	Average:31.283; most accessible tissue: Minghui63 flag leaf, score: 56.489	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002009944	NA	9.75E-06	mr1113	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	7.83E-07	1.55E-08	mr1114	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	NA	6.23E-06	mr1116	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	4.02E-06	1.64E-08	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	1.94E-06	1.04E-09	mr1118	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	3.19E-06	1.71E-07	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	4.79E-06	2.80E-07	mr1120	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	2.33E-06	6.35E-09	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	NA	8.23E-06	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	1.37E-07	1.88E-10	mr1242	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	2.01E-06	5.22E-08	mr1247	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	NA	1.26E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	7.70E-06	4.28E-08	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	NA	8.43E-07	mr1917	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	NA	2.33E-07	mr1113_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	1.13E-07	2.04E-09	mr1114_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	2.13E-07	1.63E-09	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	NA	9.39E-09	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	1.47E-06	1.24E-08	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	4.58E-07	8.89E-09	mr1120_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	4.03E-07	1.64E-09	mr1123_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	3.26E-08	5.96E-11	mr1240_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	3.93E-06	7.88E-09	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	1.74E-06	3.69E-08	mr1247_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	1.37E-06	9.61E-10	mr1495_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	4.76E-08	4.47E-11	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002009944	1.99E-06	3.35E-08	mr1936_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251