\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002006293:

Variant ID: vg1002006293 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2006293
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGTCGCGCATTGGACATTTCAGGGTGTGTTTAGCTGGCGAAAAGAAAATTTTTATGCGTTATATTGGACGTTTGACCGGATGTCGGAAGGAGTTTTTGA[C/T]
ACGAATGAAAAAATTAATTTTATAACTCGTCTGAAAACCACGAAACGAATTTATTAAGCCTGATTAATCTATCATTAGCACGTAAGAGTTATTATGGCAC

Reverse complement sequence

GTGCCATAATAACTCTTACGTGCTAATGATAGATTAATCAGGCTTAATAAATTCGTTTCGTGGTTTTCAGACGAGTTATAAAATTAATTTTTTCATTCGT[G/A]
TCAAAAACTCCTTCCGACATCCGGTCAAACGTCCAATATAACGCATAAAAATTTTCTTTTCGCCAGCTAAACACACCCTGAAATGTCCAATGCGCGACGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.60% 2.20% 1.02% 11.19% NA
All Indica  2759 83.60% 0.00% 0.87% 15.51% NA
All Japonica  1512 91.30% 6.70% 1.46% 0.60% NA
Aus  269 67.70% 0.00% 0.74% 31.60% NA
Indica I  595 83.00% 0.00% 1.34% 15.63% NA
Indica II  465 87.50% 0.00% 1.51% 10.97% NA
Indica III  913 79.40% 0.00% 0.44% 20.15% NA
Indica Intermediate  786 86.50% 0.10% 0.64% 12.72% NA
Temperate Japonica  767 95.20% 2.90% 1.17% 0.78% NA
Tropical Japonica  504 84.50% 13.10% 2.18% 0.20% NA
Japonica Intermediate  241 92.90% 5.40% 0.83% 0.83% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 93.30% 2.20% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002006293 C -> T LOC_Os10g04280.1 upstream_gene_variant ; 4706.0bp to feature; MODIFIER silent_mutation Average:57.886; most accessible tissue: Minghui63 root, score: 95.988 N N N N
vg1002006293 C -> T LOC_Os10g04270-LOC_Os10g04280 intergenic_region ; MODIFIER silent_mutation Average:57.886; most accessible tissue: Minghui63 root, score: 95.988 N N N N
vg1002006293 C -> DEL N N silent_mutation Average:57.886; most accessible tissue: Minghui63 root, score: 95.988 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1002006293 C T -0.04 -0.02 -0.03 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002006293 NA 2.78E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002006293 1.03E-06 1.03E-06 mr1424_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002006293 NA 4.14E-06 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002006293 NA 1.65E-06 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002006293 NA 4.99E-06 mr1600_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002006293 6.99E-06 6.99E-06 mr1649_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002006293 NA 1.42E-09 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251