Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001994364:

Variant ID: vg1001994364 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1994364
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, T: 0.01, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTATTTTGAATTTTGATTAATCTCATATTGGGTTCTTATATGGAAACTTCTTTCAGTATAGTTTATTTTCAATTTCGAATTTCAGTTATTTTTAGATT[G/T]
TACTTCTACTTAGACTCTCATTTTCTTTTTTTTCTTTTCTTTTTGCTAATTTCGGATTTTATCTTTATTTTATTTTGAATATTAATTAATCTCGTATTGG

Reverse complement sequence

CCAATACGAGATTAATTAATATTCAAAATAAAATAAAGATAAAATCCGAAATTAGCAAAAAGAAAAGAAAAAAAAGAAAATGAGAGTCTAAGTAGAAGTA[C/A]
AATCTAAAAATAACTGAAATTCGAAATTGAAAATAAACTATACTGAAAGAAGTTTCCATATAAGAACCCAATATGAGATTAATCAAAATTCAAAATAAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.80%	2.00%	2.67%	8.57%	NA
All Indica	2759	79.80%	3.30%	3.88%	12.98%	NA
All Japonica	1512	99.30%	0.10%	0.00%	0.53%	NA
Aus	269	81.00%	0.40%	5.95%	12.64%	NA
Indica I	595	83.00%	0.20%	2.86%	13.95%	NA
Indica II	465	68.40%	13.30%	8.60%	9.68%	NA
Indica III	913	81.20%	0.00%	3.07%	15.77%	NA
Indica Intermediate	786	82.60%	3.70%	2.80%	10.94%	NA
Temperate Japonica	767	99.50%	0.10%	0.00%	0.39%	NA
Tropical Japonica	504	99.80%	0.00%	0.00%	0.20%	NA
Japonica Intermediate	241	97.90%	0.40%	0.00%	1.66%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	92.20%	0.00%	3.33%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001994364	G -> T	LOC_Os10g04270.1	downstream_gene_variant ; 4700.0bp to feature; MODIFIER	silent_mutation	Average:13.116; most accessible tissue: Minghui63 flag leaf, score: 22.094	N	N	N	N
vg1001994364	G -> T	LOC_Os10g04260-LOC_Os10g04270	intergenic_region ; MODIFIER	silent_mutation	Average:13.116; most accessible tissue: Minghui63 flag leaf, score: 22.094	N	N	N	N
vg1001994364	G -> DEL	N	N	silent_mutation	Average:13.116; most accessible tissue: Minghui63 flag leaf, score: 22.094	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001994364	2.80E-07	1.01E-08	mr1197	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001994364	NA	1.35E-06	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001994364	NA	4.23E-07	mr1383_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251