\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001967604:

Variant ID: vg1001967604 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1967604
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGACTGCTTCTCACTTGAATATATCAAGGATAAAAAATATGAAAAGGGCCGAATGATAAACACTCAAAAGGTCCAAAAACAGATATATTTGGTAGGAAT[C/T]
CGAGTAAGAAACTCTTAAAATGATCCACCAAATATGATAAAGATCATGGTAATTAAGAAGTTCATTAGCCTAGGCTATAACCCTTACCATAATCAAAATA

Reverse complement sequence

TATTTTGATTATGGTAAGGGTTATAGCCTAGGCTAATGAACTTCTTAATTACCATGATCTTTATCATATTTGGTGGATCATTTTAAGAGTTTCTTACTCG[G/A]
ATTCCTACCAAATATATCTGTTTTTGGACCTTTTGAGTGTTTATCATTCGGCCCTTTTCATATTTTTTATCCTTGATATATTCAAGTGAGAAGCAGTCGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.80% 7.80% 0.32% 0.08% NA
All Indica  2759 99.50% 0.30% 0.14% 0.14% NA
All Japonica  1512 76.10% 23.30% 0.60% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 99.50% 0.30% 0.17% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 98.90% 0.40% 0.22% 0.44% NA
Indica Intermediate  786 99.90% 0.00% 0.13% 0.00% NA
Temperate Japonica  767 90.90% 8.60% 0.52% 0.00% NA
Tropical Japonica  504 54.20% 45.20% 0.60% 0.00% NA
Japonica Intermediate  241 75.10% 24.10% 0.83% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 90.00% 8.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001967604 C -> T LOC_Os10g04220.1 upstream_gene_variant ; 709.0bp to feature; MODIFIER silent_mutation Average:18.205; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1001967604 C -> T LOC_Os10g04210.1 downstream_gene_variant ; 3714.0bp to feature; MODIFIER silent_mutation Average:18.205; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1001967604 C -> T LOC_Os10g04230.1 downstream_gene_variant ; 3501.0bp to feature; MODIFIER silent_mutation Average:18.205; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1001967604 C -> T LOC_Os10g04210-LOC_Os10g04220 intergenic_region ; MODIFIER silent_mutation Average:18.205; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N
vg1001967604 C -> DEL N N silent_mutation Average:18.205; most accessible tissue: Minghui63 panicle, score: 29.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001967604 1.81E-06 NA mr1825 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001967604 5.31E-06 NA mr1825 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001967604 3.59E-06 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251