\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001912776:

Variant ID: vg1001912776 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1912776
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


AAACTTGCCTATCTTGAACAAGACAACTTAATCAAACTGAGCCCACTAACAGAATCGATTATCCCTAAAAAAAAAGAAGTAAAGAAGAATCGATTAGATA[C/T]
ATCAACTTGCAGTTTAAATAACAAAATGAGTAAATTGCACCTACGATAAAAAAAATCCCTGAACTGTATTGTATCAATTCATCCAGCAATCATTTTTTTC

Reverse complement sequence

GAAAAAAATGATTGCTGGATGAATTGATACAATACAGTTCAGGGATTTTTTTTATCGTAGGTGCAATTTACTCATTTTGTTATTTAAACTGCAAGTTGAT[G/A]
TATCTAATCGATTCTTCTTTACTTCTTTTTTTTTAGGGATAATCGATTCTGTTAGTGGGCTCAGTTTGATTAAGTTGTCTTGTTCAAGATAGGCAAGTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.10% 14.80% 0.15% 1.93% NA
All Indica  2759 75.50% 22.00% 0.14% 2.36% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 61.70% 29.40% 1.12% 7.81% NA
Indica I  595 57.60% 42.20% 0.17% 0.00% NA
Indica II  465 82.60% 17.20% 0.22% 0.00% NA
Indica III  913 79.10% 14.60% 0.11% 6.24% NA
Indica Intermediate  786 80.70% 18.20% 0.13% 1.02% NA
Temperate Japonica  767 99.10% 0.90% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 1.00% 0.00% 4.17% NA
Intermediate  90 92.20% 6.70% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001912776 C -> T LOC_Os10g04120.1 upstream_gene_variant ; 3460.0bp to feature; MODIFIER silent_mutation Average:63.607; most accessible tissue: Callus, score: 87.724 N N N N
vg1001912776 C -> T LOC_Os10g04130.1 upstream_gene_variant ; 376.0bp to feature; MODIFIER silent_mutation Average:63.607; most accessible tissue: Callus, score: 87.724 N N N N
vg1001912776 C -> T LOC_Os10g04120-LOC_Os10g04130 intergenic_region ; MODIFIER silent_mutation Average:63.607; most accessible tissue: Callus, score: 87.724 N N N N
vg1001912776 C -> DEL N N silent_mutation Average:63.607; most accessible tissue: Callus, score: 87.724 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001912776 5.25E-07 5.24E-07 mr1473_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001912776 2.25E-06 2.25E-06 mr1473_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001912776 2.74E-07 2.74E-07 mr1630_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001912776 7.59E-07 7.59E-07 mr1630_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251