\
| Variant ID: vg1001912776 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1912776 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 77. )
AAACTTGCCTATCTTGAACAAGACAACTTAATCAAACTGAGCCCACTAACAGAATCGATTATCCCTAAAAAAAAAGAAGTAAAGAAGAATCGATTAGATA[C/T]
ATCAACTTGCAGTTTAAATAACAAAATGAGTAAATTGCACCTACGATAAAAAAAATCCCTGAACTGTATTGTATCAATTCATCCAGCAATCATTTTTTTC
GAAAAAAATGATTGCTGGATGAATTGATACAATACAGTTCAGGGATTTTTTTTATCGTAGGTGCAATTTACTCATTTTGTTATTTAAACTGCAAGTTGAT[G/A]
TATCTAATCGATTCTTCTTTACTTCTTTTTTTTTAGGGATAATCGATTCTGTTAGTGGGCTCAGTTTGATTAAGTTGTCTTGTTCAAGATAGGCAAGTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.10% | 14.80% | 0.15% | 1.93% | NA |
| All Indica | 2759 | 75.50% | 22.00% | 0.14% | 2.36% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 61.70% | 29.40% | 1.12% | 7.81% | NA |
| Indica I | 595 | 57.60% | 42.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 82.60% | 17.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 79.10% | 14.60% | 0.11% | 6.24% | NA |
| Indica Intermediate | 786 | 80.70% | 18.20% | 0.13% | 1.02% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 1.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 92.20% | 6.70% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001912776 | C -> T | LOC_Os10g04120.1 | upstream_gene_variant ; 3460.0bp to feature; MODIFIER | silent_mutation | Average:63.607; most accessible tissue: Callus, score: 87.724 | N | N | N | N |
| vg1001912776 | C -> T | LOC_Os10g04130.1 | upstream_gene_variant ; 376.0bp to feature; MODIFIER | silent_mutation | Average:63.607; most accessible tissue: Callus, score: 87.724 | N | N | N | N |
| vg1001912776 | C -> T | LOC_Os10g04120-LOC_Os10g04130 | intergenic_region ; MODIFIER | silent_mutation | Average:63.607; most accessible tissue: Callus, score: 87.724 | N | N | N | N |
| vg1001912776 | C -> DEL | N | N | silent_mutation | Average:63.607; most accessible tissue: Callus, score: 87.724 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001912776 | 5.25E-07 | 5.24E-07 | mr1473_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001912776 | 2.25E-06 | 2.25E-06 | mr1473_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001912776 | 2.74E-07 | 2.74E-07 | mr1630_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001912776 | 7.59E-07 | 7.59E-07 | mr1630_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |