Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001912776:

Variant ID: vg1001912776 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1912776
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:

AAACTTGCCTATCTTGAACAAGACAACTTAATCAAACTGAGCCCACTAACAGAATCGATTATCCCTAAAAAAAAAGAAGTAAAGAAGAATCGATTAGATA[C/T]
ATCAACTTGCAGTTTAAATAACAAAATGAGTAAATTGCACCTACGATAAAAAAAATCCCTGAACTGTATTGTATCAATTCATCCAGCAATCATTTTTTTC

Reverse complement sequence

GAAAAAAATGATTGCTGGATGAATTGATACAATACAGTTCAGGGATTTTTTTTATCGTAGGTGCAATTTACTCATTTTGTTATTTAAACTGCAAGTTGAT[G/A]
TATCTAATCGATTCTTCTTTACTTCTTTTTTTTTAGGGATAATCGATTCTGTTAGTGGGCTCAGTTTGATTAAGTTGTCTTGTTCAAGATAGGCAAGTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.10%	14.80%	0.15%	1.93%	NA
All Indica	2759	75.50%	22.00%	0.14%	2.36%	NA
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	61.70%	29.40%	1.12%	7.81%	NA
Indica I	595	57.60%	42.20%	0.17%	0.00%	NA
Indica II	465	82.60%	17.20%	0.22%	0.00%	NA
Indica III	913	79.10%	14.60%	0.11%	6.24%	NA
Indica Intermediate	786	80.70%	18.20%	0.13%	1.02%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	94.80%	1.00%	0.00%	4.17%	NA
Intermediate	90	92.20%	6.70%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001912776	C -> T	LOC_Os10g04120.1	upstream_gene_variant ; 3460.0bp to feature; MODIFIER	silent_mutation	Average:63.607; most accessible tissue: Callus, score: 87.724	N	N	N	N
vg1001912776	C -> T	LOC_Os10g04130.1	upstream_gene_variant ; 376.0bp to feature; MODIFIER	silent_mutation	Average:63.607; most accessible tissue: Callus, score: 87.724	N	N	N	N
vg1001912776	C -> T	LOC_Os10g04120-LOC_Os10g04130	intergenic_region ; MODIFIER	silent_mutation	Average:63.607; most accessible tissue: Callus, score: 87.724	N	N	N	N
vg1001912776	C -> DEL	N	N	silent_mutation	Average:63.607; most accessible tissue: Callus, score: 87.724	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001912776	5.25E-07	5.24E-07	mr1473_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001912776	2.25E-06	2.25E-06	mr1473_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001912776	2.74E-07	2.74E-07	mr1630_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001912776	7.59E-07	7.59E-07	mr1630_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251