Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001912628:

Variant ID: vg1001912628 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1912628
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCATGTGTGCATGTGTTGTGGGCACTGTGTTTGTAATGTGTTTCTATAAAAAAAAGTTAGCGAAAGATTTATTTGCACCTGTCTGCTTTTGCCTAATTA[T/C]
GTCCTAAGAACTTTATTGAATAAATAGTTCAACGAGATGAATATGGAAAACTTGCCTATCTTGAACAAGACAACTTAATCAAACTGAGCCCACTAACAGA

Reverse complement sequence

TCTGTTAGTGGGCTCAGTTTGATTAAGTTGTCTTGTTCAAGATAGGCAAGTTTTCCATATTCATCTCGTTGAACTATTTATTCAATAAAGTTCTTAGGAC[A/G]
TAATTAGGCAAAAGCAGACAGGTGCAAATAAATCTTTCGCTAACTTTTTTTTATAGAAACACATTACAAACACAGTGCCCACAACACATGCACACATGCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.10%	32.20%	3.58%	2.12%	NA
All Indica	2759	85.80%	7.00%	4.68%	2.54%	NA
All Japonica	1512	28.50%	69.50%	1.98%	0.00%	NA
Aus	269	33.10%	55.00%	2.60%	9.29%	NA
Indica I	595	87.90%	2.20%	9.92%	0.00%	NA
Indica II	465	94.00%	3.40%	2.58%	0.00%	NA
Indica III	913	82.60%	7.20%	3.50%	6.68%	NA
Indica Intermediate	786	83.00%	12.60%	3.31%	1.15%	NA
Temperate Japonica	767	11.70%	86.70%	1.56%	0.00%	NA
Tropical Japonica	504	53.20%	44.80%	1.98%	0.00%	NA
Japonica Intermediate	241	30.30%	66.40%	3.32%	0.00%	NA
VI/Aromatic	96	2.10%	93.80%	0.00%	4.17%	NA
Intermediate	90	51.10%	44.40%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001912628	T -> C	LOC_Os10g04120.1	upstream_gene_variant ; 3312.0bp to feature; MODIFIER	silent_mutation	Average:66.626; most accessible tissue: Minghui63 panicle, score: 85.069	N	N	N	N
vg1001912628	T -> C	LOC_Os10g04130.1	upstream_gene_variant ; 524.0bp to feature; MODIFIER	silent_mutation	Average:66.626; most accessible tissue: Minghui63 panicle, score: 85.069	N	N	N	N
vg1001912628	T -> C	LOC_Os10g04120-LOC_Os10g04130	intergenic_region ; MODIFIER	silent_mutation	Average:66.626; most accessible tissue: Minghui63 panicle, score: 85.069	N	N	N	N
vg1001912628	T -> DEL	N	N	silent_mutation	Average:66.626; most accessible tissue: Minghui63 panicle, score: 85.069	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001912628	8.08E-06	8.08E-06	mr1030	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001912628	NA	4.83E-06	mr1044	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001912628	NA	2.18E-06	mr1292	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001912628	NA	1.63E-09	mr1342	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001912628	1.57E-06	NA	mr1342	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001912628	2.42E-06	2.42E-06	mr1385	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001912628	8.91E-07	4.33E-09	mr1428	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001912628	1.83E-06	1.83E-06	mr1464	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001912628	NA	3.19E-08	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001912628	NA	1.37E-06	mr1570	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001912628	NA	8.25E-06	mr1614	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001912628	NA	5.77E-06	mr1691	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001912628	NA	1.93E-06	mr1693	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001912628	NA	5.31E-06	mr1736	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251