| Variant ID: vg1001652766 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1652766 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTTCTAAGATTATTGGATTTTTGGTCTAAAGGAAAAAGGATTTAATTAAACCCTTTTGAAAAAGAAAAGAAAGAGGGAGGGGAAACAGACTTCCCTCGGG[T/C]
GGCTAGGGCGCGGCCCGAGAGAAAGGGGCGGCTCGGCCGAGCTTAATGGGCCGGCCGGCCCGAGAAGACGGCCCGAAGGCACGCGCGGGAGGGGAGGAGA
TCTCCTCCCCTCCCGCGCGTGCCTTCGGGCCGTCTTCTCGGGCCGGCCGGCCCATTAAGCTCGGCCGAGCCGCCCCTTTCTCTCGGGCCGCGCCCTAGCC[A/G]
CCCGAGGGAAGTCTGTTTCCCCTCCCTCTTTCTTTTCTTTTTCAAAAGGGTTTAATTAAATCCTTTTTCCTTTAGACCAAAAATCCAATAATCTTAGAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.50% | 42.70% | 5.18% | 8.59% | NA |
| All Indica | 2759 | 14.10% | 64.60% | 7.14% | 14.17% | NA |
| All Japonica | 1512 | 94.30% | 5.20% | 0.00% | 0.46% | NA |
| Aus | 269 | 36.80% | 46.80% | 15.61% | 0.74% | NA |
| Indica I | 595 | 13.90% | 54.80% | 5.04% | 26.22% | NA |
| Indica II | 465 | 9.20% | 66.50% | 9.25% | 15.05% | NA |
| Indica III | 913 | 14.80% | 68.30% | 7.78% | 9.09% | NA |
| Indica Intermediate | 786 | 16.40% | 66.40% | 6.74% | 10.43% | NA |
| Temperate Japonica | 767 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 86.10% | 12.70% | 0.00% | 1.19% | NA |
| Japonica Intermediate | 241 | 97.90% | 1.70% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 92.70% | 6.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 60.00% | 27.80% | 5.56% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001652766 | T -> C | LOC_Os10g03690.1 | downstream_gene_variant ; 3838.0bp to feature; MODIFIER | silent_mutation | Average:34.274; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg1001652766 | T -> C | LOC_Os10g03669-LOC_Os10g03690 | intergenic_region ; MODIFIER | silent_mutation | Average:34.274; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| vg1001652766 | T -> DEL | N | N | silent_mutation | Average:34.274; most accessible tissue: Minghui63 panicle, score: 82.797 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001652766 | NA | 2.28E-15 | mr1323 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001652766 | 2.63E-06 | NA | mr1486 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001652766 | 2.26E-07 | 6.73E-08 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001652766 | NA | 2.77E-06 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001652766 | NA | 2.37E-06 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |