Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001651113:

Variant ID: vg1001651113 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 1651113
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.19, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

CGATACCAGTCCCAGGAATCAGTGCTGGTATCACAGGAACGCATAATACTACAGCAACAGAGGTCTCTTTATTACAGAGTAGGGGTACAGTCATGTTGGG[C/T]
TGCGGACAGATCCCGAGCTCACAACTGCATTACAAAAGGGAAAGCGGAAGCCTAAGATTTGGACCAATCATCACAGGCATGACTTGGGAACTAGGCCGAA

Reverse complement sequence

TTCGGCCTAGTTCCCAAGTCATGCCTGTGATGATTGGTCCAAATCTTAGGCTTCCGCTTTCCCTTTTGTAATGCAGTTGTGAGCTCGGGATCTGTCCGCA[G/A]
CCCAACATGACTGTACCCCTACTCTGTAATAAAGAGACCTCTGTTGCTGTAGTATTATGCGTTCCTGTGATACCAGCACTGATTCCTGGGACTGGTATCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.50%	11.70%	0.42%	18.43%	NA
All Indica	2759	60.50%	11.10%	0.69%	27.76%	NA
All Japonica	1512	95.80%	3.60%	0.00%	0.53%	NA
Aus	269	2.20%	65.80%	0.37%	31.60%	NA
Indica I	595	58.80%	2.00%	1.18%	37.98%	NA
Indica II	465	70.80%	2.40%	0.65%	26.24%	NA
Indica III	913	54.50%	18.60%	0.33%	26.51%	NA
Indica Intermediate	786	62.60%	14.20%	0.76%	22.39%	NA
Temperate Japonica	767	99.10%	0.80%	0.00%	0.13%	NA
Tropical Japonica	504	89.50%	9.30%	0.00%	1.19%	NA
Japonica Intermediate	241	98.80%	0.80%	0.00%	0.41%	NA
VI/Aromatic	96	91.70%	7.30%	0.00%	1.04%	NA
Intermediate	90	80.00%	7.80%	0.00%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1001651113	C -> T	LOC_Os10g03669.1	upstream_gene_variant ; 4211.0bp to feature; MODIFIER	silent_mutation	Average:29.959; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg1001651113	C -> T	LOC_Os10g03669-LOC_Os10g03690	intergenic_region ; MODIFIER	silent_mutation	Average:29.959; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg1001651113	C -> DEL	N	N	silent_mutation	Average:29.959; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1001651113	1.06E-08	NA	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001651113	3.13E-15	5.16E-14	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001651113	3.73E-08	NA	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001651113	5.81E-13	2.89E-12	mr1548	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001651113	5.70E-06	NA	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001651113	3.51E-08	1.55E-07	mr1588	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001651113	3.42E-09	NA	mr1486_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001651113	2.00E-16	1.62E-13	mr1486_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001651113	7.33E-10	NA	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001651113	6.62E-16	4.04E-14	mr1588_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251