\
| Variant ID: vg1001651113 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1651113 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.19, others allele: 0.00, population size: 103. )
CGATACCAGTCCCAGGAATCAGTGCTGGTATCACAGGAACGCATAATACTACAGCAACAGAGGTCTCTTTATTACAGAGTAGGGGTACAGTCATGTTGGG[C/T]
TGCGGACAGATCCCGAGCTCACAACTGCATTACAAAAGGGAAAGCGGAAGCCTAAGATTTGGACCAATCATCACAGGCATGACTTGGGAACTAGGCCGAA
TTCGGCCTAGTTCCCAAGTCATGCCTGTGATGATTGGTCCAAATCTTAGGCTTCCGCTTTCCCTTTTGTAATGCAGTTGTGAGCTCGGGATCTGTCCGCA[G/A]
CCCAACATGACTGTACCCCTACTCTGTAATAAAGAGACCTCTGTTGCTGTAGTATTATGCGTTCCTGTGATACCAGCACTGATTCCTGGGACTGGTATCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.50% | 11.70% | 0.42% | 18.43% | NA |
| All Indica | 2759 | 60.50% | 11.10% | 0.69% | 27.76% | NA |
| All Japonica | 1512 | 95.80% | 3.60% | 0.00% | 0.53% | NA |
| Aus | 269 | 2.20% | 65.80% | 0.37% | 31.60% | NA |
| Indica I | 595 | 58.80% | 2.00% | 1.18% | 37.98% | NA |
| Indica II | 465 | 70.80% | 2.40% | 0.65% | 26.24% | NA |
| Indica III | 913 | 54.50% | 18.60% | 0.33% | 26.51% | NA |
| Indica Intermediate | 786 | 62.60% | 14.20% | 0.76% | 22.39% | NA |
| Temperate Japonica | 767 | 99.10% | 0.80% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 89.50% | 9.30% | 0.00% | 1.19% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.80% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 91.70% | 7.30% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 80.00% | 7.80% | 0.00% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001651113 | C -> T | LOC_Os10g03669.1 | upstream_gene_variant ; 4211.0bp to feature; MODIFIER | silent_mutation | Average:29.959; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg1001651113 | C -> T | LOC_Os10g03669-LOC_Os10g03690 | intergenic_region ; MODIFIER | silent_mutation | Average:29.959; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg1001651113 | C -> DEL | N | N | silent_mutation | Average:29.959; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001651113 | 1.06E-08 | NA | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001651113 | 3.13E-15 | 5.16E-14 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001651113 | 3.73E-08 | NA | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001651113 | 5.81E-13 | 2.89E-12 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001651113 | 5.70E-06 | NA | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001651113 | 3.51E-08 | 1.55E-07 | mr1588 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001651113 | 3.42E-09 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001651113 | 2.00E-16 | 1.62E-13 | mr1486_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001651113 | 7.33E-10 | NA | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001651113 | 6.62E-16 | 4.04E-14 | mr1588_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |