\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001651113:

Variant ID: vg1001651113 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1651113
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.19, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CGATACCAGTCCCAGGAATCAGTGCTGGTATCACAGGAACGCATAATACTACAGCAACAGAGGTCTCTTTATTACAGAGTAGGGGTACAGTCATGTTGGG[C/T]
TGCGGACAGATCCCGAGCTCACAACTGCATTACAAAAGGGAAAGCGGAAGCCTAAGATTTGGACCAATCATCACAGGCATGACTTGGGAACTAGGCCGAA

Reverse complement sequence

TTCGGCCTAGTTCCCAAGTCATGCCTGTGATGATTGGTCCAAATCTTAGGCTTCCGCTTTCCCTTTTGTAATGCAGTTGTGAGCTCGGGATCTGTCCGCA[G/A]
CCCAACATGACTGTACCCCTACTCTGTAATAAAGAGACCTCTGTTGCTGTAGTATTATGCGTTCCTGTGATACCAGCACTGATTCCTGGGACTGGTATCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.50% 11.70% 0.42% 18.43% NA
All Indica  2759 60.50% 11.10% 0.69% 27.76% NA
All Japonica  1512 95.80% 3.60% 0.00% 0.53% NA
Aus  269 2.20% 65.80% 0.37% 31.60% NA
Indica I  595 58.80% 2.00% 1.18% 37.98% NA
Indica II  465 70.80% 2.40% 0.65% 26.24% NA
Indica III  913 54.50% 18.60% 0.33% 26.51% NA
Indica Intermediate  786 62.60% 14.20% 0.76% 22.39% NA
Temperate Japonica  767 99.10% 0.80% 0.00% 0.13% NA
Tropical Japonica  504 89.50% 9.30% 0.00% 1.19% NA
Japonica Intermediate  241 98.80% 0.80% 0.00% 0.41% NA
VI/Aromatic  96 91.70% 7.30% 0.00% 1.04% NA
Intermediate  90 80.00% 7.80% 0.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001651113 C -> T LOC_Os10g03669.1 upstream_gene_variant ; 4211.0bp to feature; MODIFIER silent_mutation Average:29.959; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg1001651113 C -> T LOC_Os10g03669-LOC_Os10g03690 intergenic_region ; MODIFIER silent_mutation Average:29.959; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg1001651113 C -> DEL N N silent_mutation Average:29.959; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001651113 1.06E-08 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001651113 3.13E-15 5.16E-14 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001651113 3.73E-08 NA mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001651113 5.81E-13 2.89E-12 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001651113 5.70E-06 NA mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001651113 3.51E-08 1.55E-07 mr1588 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001651113 3.42E-09 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001651113 2.00E-16 1.62E-13 mr1486_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001651113 7.33E-10 NA mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001651113 6.62E-16 4.04E-14 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251