\
| Variant ID: vg1001623967 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1623967 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGGACATCACCAGCAGTACCAAAATTACTGAAATCATTGGCAAGATAAACTGAAGCAGACACTAGTGATGCCATGTCCTGTAGCAAAGGTACCCGCCCTT[T/G]
CGGACCAAACAATGTCAGAGCAGTGACGCTCGGAGTGGAAATGCAGCAATCGTACTTGTCAACGAAACTGAAATCAGAGATATTGATTGTGAGGATCTTC
GAAGATCCTCACAATCAATATCTCTGATTTCAGTTTCGTTGACAAGTACGATTGCTGCATTTCCACTCCGAGCGTCACTGCTCTGACATTGTTTGGTCCG[A/C]
AAGGGCGGGTACCTTTGCTACAGGACATGGCATCACTAGTGTCTGCTTCAGTTTATCTTGCCAATGATTTCAGTAATTTTGGTACTGCTGGTGATGTCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.10% | 35.90% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 96.20% | 3.80% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 5.50% | 94.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 91.40% | 8.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 14.10% | 85.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 56.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001623967 | T -> G | LOC_Os10g03660.1 | missense_variant ; p.Lys892Gln; MODERATE | nonsynonymous_codon ; K892Q | Average:69.376; most accessible tissue: Zhenshan97 panicle, score: 81.135 | benign |
-0.897 |
TOLERATED | 0.65 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001623967 | NA | 6.41E-06 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001623967 | 1.51E-08 | 9.30E-06 | mr1004 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001623967 | NA | 3.93E-10 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001623967 | 6.47E-08 | NA | mr1005 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001623967 | 5.06E-07 | NA | mr1011 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001623967 | 4.58E-07 | 8.40E-06 | mr1012 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001623967 | NA | 6.94E-08 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001623967 | NA | 7.13E-26 | mr1686 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |