\
| Variant ID: vg1001580134 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1580134 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 43. )
TTTGAATTTTAAAAATTAACAAATGAAGTAAAGCATTTCCAAAAAAAAAATATAGTTTTGTAGTAGACCACAAACATAGACAAATTTGTCCAGAGTAAAT[G/A]
AAATTTAGTTATATGTTGCCAGTATGGTTTTATTCTGATTTAGGCACTATTTTTTGGAATAATTATACTTTATTTTGCCCATAGAAAAAAATATCTAAGT
ACTTAGATATTTTTTTCTATGGGCAAAATAAAGTATAATTATTCCAAAAAATAGTGCCTAAATCAGAATAAAACCATACTGGCAACATATAACTAAATTT[C/T]
ATTTACTCTGGACAAATTTGTCTATGTTTGTGGTCTACTACAAAACTATATTTTTTTTTTGGAAATGCTTTACTTCATTTGTTAATTTTTAAAATTCAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.20% | 4.20% | 6.64% | 47.88% | NA |
| All Indica | 2759 | 13.10% | 6.30% | 10.91% | 69.66% | NA |
| All Japonica | 1512 | 94.20% | 0.10% | 0.20% | 5.42% | NA |
| Aus | 269 | 7.40% | 7.80% | 1.49% | 83.27% | NA |
| Indica I | 595 | 4.00% | 11.30% | 18.99% | 65.71% | NA |
| Indica II | 465 | 11.00% | 7.10% | 13.76% | 68.17% | NA |
| Indica III | 913 | 18.20% | 3.00% | 6.35% | 72.51% | NA |
| Indica Intermediate | 786 | 15.30% | 6.10% | 8.40% | 70.23% | NA |
| Temperate Japonica | 767 | 98.30% | 0.00% | 0.00% | 1.69% | NA |
| Tropical Japonica | 504 | 86.70% | 0.20% | 0.40% | 12.70% | NA |
| Japonica Intermediate | 241 | 97.10% | 0.40% | 0.41% | 2.07% | NA |
| VI/Aromatic | 96 | 88.50% | 0.00% | 1.04% | 10.42% | NA |
| Intermediate | 90 | 64.40% | 2.20% | 5.56% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001580134 | G -> A | LOC_Os10g03630-LOC_Os10g03640 | intergenic_region ; MODIFIER | silent_mutation | Average:21.584; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg1001580134 | G -> DEL | N | N | silent_mutation | Average:21.584; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001580134 | 1.83E-06 | NA | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001580134 | 1.81E-08 | 2.97E-13 | mr1486 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001580134 | 8.12E-07 | 2.35E-09 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001580134 | 9.79E-06 | 5.39E-09 | mr1721 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001580134 | 3.74E-06 | NA | mr1168_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001580134 | 7.64E-07 | 1.20E-08 | mr1168_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001580134 | 4.11E-06 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001580134 | 5.55E-08 | 4.82E-13 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001580134 | NA | 4.67E-08 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |