\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1001527825:

Variant ID: vg1001527825 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 1527825
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ACGCTAGAGTGTCCCTCTTATTCGAGACGCATGCGAATTAATTGGGCCGCACCTTTTCACGTGCCCCTTACCTCACGCACCAATCGGGCGTGCATGAGAC[C/T]
GTTTTCCACACGCACCTTTGCGCGCCACCGCGATTGGGCCCGCAACACCCTCGCGCACACGATTTTCCGCATGCCCAATTGGGCCCGCGACGCTCTCACG

Reverse complement sequence

CGTGAGAGCGTCGCGGGCCCAATTGGGCATGCGGAAAATCGTGTGCGCGAGGGTGTTGCGGGCCCAATCGCGGTGGCGCGCAAAGGTGCGTGTGGAAAAC[G/A]
GTCTCATGCACGCCCGATTGGTGCGTGAGGTAAGGGGCACGTGAAAAGGTGCGGCCCAATTAATTCGCATGCGTCTCGAATAAGAGGGACACTCTAGCGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.60% 33.30% 1.02% 1.14% NA
All Indica  2759 41.00% 55.30% 1.67% 1.96% NA
All Japonica  1512 99.00% 1.00% 0.00% 0.00% NA
Aus  269 96.70% 2.60% 0.74% 0.00% NA
Indica I  595 42.40% 57.00% 0.50% 0.17% NA
Indica II  465 32.90% 63.70% 1.72% 1.72% NA
Indica III  913 43.70% 49.60% 2.63% 4.05% NA
Indica Intermediate  786 41.70% 55.90% 1.40% 1.02% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1001527825 C -> T LOC_Os10g03530.1 upstream_gene_variant ; 1531.0bp to feature; MODIFIER silent_mutation Average:53.603; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg1001527825 C -> T LOC_Os10g03540.1 upstream_gene_variant ; 2734.0bp to feature; MODIFIER silent_mutation Average:53.603; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg1001527825 C -> T LOC_Os10g03550.1 upstream_gene_variant ; 4969.0bp to feature; MODIFIER silent_mutation Average:53.603; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg1001527825 C -> T LOC_Os10g03550.2 upstream_gene_variant ; 4969.0bp to feature; MODIFIER silent_mutation Average:53.603; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg1001527825 C -> T LOC_Os10g03550.3 upstream_gene_variant ; 4969.0bp to feature; MODIFIER silent_mutation Average:53.603; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg1001527825 C -> T LOC_Os10g03520.1 downstream_gene_variant ; 3388.0bp to feature; MODIFIER silent_mutation Average:53.603; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg1001527825 C -> T LOC_Os10g03530-LOC_Os10g03540 intergenic_region ; MODIFIER silent_mutation Average:53.603; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N
vg1001527825 C -> DEL N N silent_mutation Average:53.603; most accessible tissue: Zhenshan97 panicle, score: 63.607 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1001527825 NA 2.80E-06 mr1158 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001527825 7.62E-12 NA mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001527825 8.51E-13 2.63E-14 mr1486 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001527825 1.05E-10 NA mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001527825 2.29E-10 5.96E-11 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001527825 5.27E-06 3.56E-06 mr1588 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001527825 8.96E-06 NA mr1721 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001527825 NA 2.43E-06 mr1721 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001527825 2.84E-10 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001527825 3.53E-11 7.92E-13 mr1486_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001527825 7.42E-06 NA mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001527825 3.93E-09 NA mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1001527825 1.57E-08 4.28E-10 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251