\
| Variant ID: vg1001527825 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 1527825 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 117. )
ACGCTAGAGTGTCCCTCTTATTCGAGACGCATGCGAATTAATTGGGCCGCACCTTTTCACGTGCCCCTTACCTCACGCACCAATCGGGCGTGCATGAGAC[C/T]
GTTTTCCACACGCACCTTTGCGCGCCACCGCGATTGGGCCCGCAACACCCTCGCGCACACGATTTTCCGCATGCCCAATTGGGCCCGCGACGCTCTCACG
CGTGAGAGCGTCGCGGGCCCAATTGGGCATGCGGAAAATCGTGTGCGCGAGGGTGTTGCGGGCCCAATCGCGGTGGCGCGCAAAGGTGCGTGTGGAAAAC[G/A]
GTCTCATGCACGCCCGATTGGTGCGTGAGGTAAGGGGCACGTGAAAAGGTGCGGCCCAATTAATTCGCATGCGTCTCGAATAAGAGGGACACTCTAGCGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.60% | 33.30% | 1.02% | 1.14% | NA |
| All Indica | 2759 | 41.00% | 55.30% | 1.67% | 1.96% | NA |
| All Japonica | 1512 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 96.70% | 2.60% | 0.74% | 0.00% | NA |
| Indica I | 595 | 42.40% | 57.00% | 0.50% | 0.17% | NA |
| Indica II | 465 | 32.90% | 63.70% | 1.72% | 1.72% | NA |
| Indica III | 913 | 43.70% | 49.60% | 2.63% | 4.05% | NA |
| Indica Intermediate | 786 | 41.70% | 55.90% | 1.40% | 1.02% | NA |
| Temperate Japonica | 767 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1001527825 | C -> T | LOC_Os10g03530.1 | upstream_gene_variant ; 1531.0bp to feature; MODIFIER | silent_mutation | Average:53.603; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1001527825 | C -> T | LOC_Os10g03540.1 | upstream_gene_variant ; 2734.0bp to feature; MODIFIER | silent_mutation | Average:53.603; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1001527825 | C -> T | LOC_Os10g03550.1 | upstream_gene_variant ; 4969.0bp to feature; MODIFIER | silent_mutation | Average:53.603; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1001527825 | C -> T | LOC_Os10g03550.2 | upstream_gene_variant ; 4969.0bp to feature; MODIFIER | silent_mutation | Average:53.603; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1001527825 | C -> T | LOC_Os10g03550.3 | upstream_gene_variant ; 4969.0bp to feature; MODIFIER | silent_mutation | Average:53.603; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1001527825 | C -> T | LOC_Os10g03520.1 | downstream_gene_variant ; 3388.0bp to feature; MODIFIER | silent_mutation | Average:53.603; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1001527825 | C -> T | LOC_Os10g03530-LOC_Os10g03540 | intergenic_region ; MODIFIER | silent_mutation | Average:53.603; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| vg1001527825 | C -> DEL | N | N | silent_mutation | Average:53.603; most accessible tissue: Zhenshan97 panicle, score: 63.607 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1001527825 | NA | 2.80E-06 | mr1158 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001527825 | 7.62E-12 | NA | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001527825 | 8.51E-13 | 2.63E-14 | mr1486 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001527825 | 1.05E-10 | NA | mr1548 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001527825 | 2.29E-10 | 5.96E-11 | mr1548 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001527825 | 5.27E-06 | 3.56E-06 | mr1588 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001527825 | 8.96E-06 | NA | mr1721 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001527825 | NA | 2.43E-06 | mr1721 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001527825 | 2.84E-10 | NA | mr1486_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001527825 | 3.53E-11 | 7.92E-13 | mr1486_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001527825 | 7.42E-06 | NA | mr1588_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001527825 | 3.93E-09 | NA | mr1721_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1001527825 | 1.57E-08 | 4.28E-10 | mr1721_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |